Category:Reference R-Genes, manually curated

From PRG Wiki
(Difference between revisions)
Jump to: navigation, search
(Undo revision 116377 by JackVossen (talk))
Line 1: Line 1:
Name Genbank_locus Species Location Start End DNA Prot Comment
More info at [[Reference R-Genes, manually curated]]
R3b NFSFS Solanum demissum 1 3852 atggaaattggcttagcagttggtggtgcatttctctcttcagctttgaatgttctctttgacaggcttgctcctaatagtgatctgttgaagatgtttaagagggacaagcgtgatgttcggctcttaaagaagctgaggatgactttgcttggccttcaggctgtgttaagtgatgcggagaataagcaagcatcaaatccatacgtgagccagtggcttaatgagcttcaagatgctgtggacggtgctgaaaacttaattgaagaagtcaattatgaagttttgagactaaaggtggaaggtcagtgtcaaaatcttggagaaacaagcaatcaacaggtaagtgactgcaacctgtgcttgagtgatgatttttttcttaacataaaggagaagttggaagagaccattgaaacattggaagagttggaaaagcaaattggtcgccttgatctaacaaagtatcttgattcgggtaaacaagaaacaagggaatcttcaacttctgttgttgatgaatctgatatcttaggtaggcagaacgaaatagagggattgattgaccgtttgttgtctgaggatggaaagaatctgactgtagttcctgttgttggaatggggggcgtgggcaagacaacacttgctaaagctgtttacaatgatgagaaagtaaaaaaccattttggtttcaaagcttggatctgtgtgtctgaaccatatgatattctcagaataacaaaggagttacttcaagaatttggcttaatggttgataacaatctgaatcaacttcaagtcaaattgaaggagagcttaaagggaaaaaagtttcttattgtcctagatgatgtatggaatgaaaactataaagagtgggatgacttgagaaatctttttgtacaaggagatgtaggaagtaagatcattgtgacgacacgtaaggagagtgttgccttgatgatgggttgtggggcaatcaacgtggggactctatctagtgaagtctcttgggatcttttcaagcggcattcatttgaaaatagggatcctaaggaacatccagaacttgaagagattggaatacaaattgcatacaagtgcaaaggtttgcctttagctctaaaggcacttgctggtattttacgctccaaatcagaggtggatgagtggagacacattttaagaagtgaaatatgggagctgcaaagtcgttcgaatggaatcttaccagcgttgatgttgagctataatgatcttcctccacaattgaagcggtgttttgctttttgtgcaatatatccgaaagattatctattttgcaaagaacaagttgttcacctgtggattgctaatggtcttgtacagcagttgcattcagctaaccaatactttctcgagttgagatcgcgatcattgtttgaaaaggtccgagagtcttctaaatggaattcgggggaattcttaatgcatgaccttgtcaacgatttggcccaaattgcatcttcaaatctgtgtatgaggttggaagagaaccaaggatctcatatgttggaacgaactcgacatttgtcgtattcaatgggtgatggtgatttcggtaaactgaaaaccctcaacaaattggagcaattgaggacattgcttcccatcaatatccagcggcgtccatgccatcttaagaagaggatgcttcatgacatatttccaagactaatatccctaagggcactatcactgtctccttatgatattgaggagttgccgaatgacttgtttatcaaattgaagcacctaaaatttttggacctttcttggacacagataaaaaagttgccagattcaatttgtgaactgtacagcttagagatacttatcttgtcacattgtagtcatcttaatgagccaccgctgcagatggagaagttgatcaacttgcatcacctcgacgttagcgacgcttatttcttgaagacgccgctacatgtgagcaagttgaaaaatctccatgtgctagtgggagctaaattttttcttactggttccagtggtttgagaattgaagatttgggtgaactacataacttgtatggatctctatcaattctagagttgcaacatgtggtagatagaagggaatctctgaaggcaaatatgagggaaaagaaacatgttgaaaggttatctttggagtgggggggaagttttgctgacaattcacaaactgaaagagacatacttgatgagctacaaccaaatacaaacataaaagaactccgaatcactggctatagaggaacaaaatttccaaattggctagctgatcattcatttcataagctaatagaaatgtctcttagctactgcaaggactgtgattccttgccagcactaggacagcttccttgtttaaaatcccttaccattagagggatgcatcaaataacagaggtgagtgaagagttctatggtcgtttttcctccacaaagccatttaactctcttgagaaacttgaatttgcagagatgccggagtggaagcagtggcatgtactggggaagggagagttccctgtactagaggaacttttgatttatcgttgcccaaagttgattgggaagttgcctgaaaatgtttcttcgctgagaagattgagaattttaaaatgccctgaactcagtttggagacacctatccaactttcaaatttaaaagagtttgaagttgctgatgctcaactgtttacatctcaacttgaaggaatgaagcagattgttaaattagatattactgattgtaagtctcttacctccttacctattagcattctgccgagtaccttgaagagaataagaatagctttttgtggggagctgaaattggaggcgtcgatgaatgctatgtttctcgagaaattgtctctagtaaaatgtgattctcctgagttggtcccaagagcacgcaatttgagtgtaagaagttgcaacaaccttactaggcttttgattcctactgccactgaaagactcagtattagagattatgataatcttgaaatactttcagtggcacgtgggactcagatgacatcattgaatatttacgactgcaagaagctgaagtcgctgccagaacatatgcaggaactccttccatctcttaagaaactggttgtgcaagcttgtccagaaatagagtcctttcctgaaggaggattgcccttcaatttacaagccctttcaatctggaattgcaagaaactggtgaatggccgaaaagagtggcatttacagagactcccctctctcatagatttaaccatctaccatgatggtagcgatgaagaggttcttgctggtgaaaaatgggagttgccttgctctattcgaaggcttactatatccaatctgaaaacattaagcagccaacttctcaaaagcctcacctcccttgagtacctagatgctagagagttgcctcaaattcagtcactgctggaagaagggcttcctttctctctttctgagctaatattatttagtaatcatgatcttcattcactaccgacagaaggtcttcagcatctcacgtggcttcgacgtctagagattgtgggttgccctagtctccaatctcttcccgaatcggggttgccctcctccctctctgagctgggcatttggaattgctctaatcttcaatctcttcccgaatcagggatgcccccttccatctctaaactacgcatttccgaatgcccattgctcaaaccactcctagaatttaacaagggggattactggccaaaaattgctcatattcccaccatatatattgataaggaatactag MEIGLAVGGAFLSSALNVLFDRLAPNSDLLKMFKRDKRDVRLLKKLRMTLLGLQAVLSDAENKQASNPYVSQWLNELQDAVDGAENLIEEVNYEVLRLKVEGQCQNLGETSNQQVSDCNLCLSDDFFLNIKEKLEETIETLEELEKQIGRLDLTKYLDSGKQETRESSTSVVDESDILGRQNEIEGLIDRLLSEDGKNLTVVPVVGMGGVGKTTLAKAVYNDEKVKNHFGFKAWICVSEPYDILRITKELLQEFGLMVDNNLNQLQVKLKESLKGKKFLIVLDDVWNENYKEWDDLRNLFVQGDVGSKIIVTTRKESVALMMGCGAINVGTLSSEVSWDLFKRHSFENRDPKEHPELEEIGIQIAYKCKGLPLALKALAGILRSKSEVDEWRHILRSEIWELQSRSNGILPALMLSYNDLPPQLKRCFAFCAIYPKDYLFCKEQVVHLWIANGLVQQLHSANQYFLELRSRSLFEKVRESSKWNSGEFLMHDLVNDLAQIASSNLCMRLEENQGSHMLERTRHLSYSMGDGDFGKLKTLNKLEQLRTLLPINIQRRPCHLKKRMLHDIFPRLISLRALSLSPYDIEELPNDLFIKLKHLKFLDLSWTQIKKLPDSICELYSLEILILSHCSHLNEPPLQMEKLINLHHLDVSDAYFLKTPLHVSKLKNLHVLVGAKFFLTGSSGLRIEDLGELHNLYGSLSILELQHVVDRRESLKANMREKKHVERLSLEWGGSFADNSQTERDILDELQPNTNIKELRITGYRGTKFPNWLADHSFHKLIEMSLSYCKDCDSLPALGQLPCLKSLTIRGMHQITEVSEEFYGRFSSTKPFNSLEKLEFAEMPEWKQWHVLGKGEFPVLEELLIYRCPKLIGKLPENVSSLRRLRILKCPELSLETPIQLSNLKEFEVADAQLFTSQLEGMKQIVKLDITDCKSLTSLPISILPSTLKRIRIAFCGELKLEASMNAMFLEKLSLVKCDSPELVPRARNLSVRSCNNLTRLLIPTATERLSIRDYDNLEILSVARGTQMTSLNIYDCKKLKSLPEHMQELLPSLKKLVVQACPEIESFPEGGLPFNLQALSIWNCKKLVNGRKEWHLQRLPSLIDLTIYHDGSDEEVLAGEKWELPCSIRRLTISNLKTLSSQLLKSLTSLEYLDARELPQIQSLLEEGLPFSLSELILFSNHDLHSLPTEGLQHLTWLRRLEIVGCPSLQSLPESGLPSSLSELGIWNCSNLQSLPESGMPPSISKLRISECPLLKPLLEFNKGDYWPKIAHIPTIYIDKEY PMID: 21649512
Rpi-vnt1.1 NF4FS Solanum venturii 710 3385 agttatacaccctacattctactcgagtcattatgatgatgtctcacgaccaaatcaaatcaaagttaaataaatatcgaaccgaacgcccactctgtatgagtatggcaaaagattttgagagaatcaagttgcataaaagcctaattttcatggaacatacaaattgagtctcataatagcccaaactcacagccatgaacccaaattgggtaaagttttgcaagacgttcatcaaacagttaggaaacataaaatggcgctagatatataataaatttttttaacatatggtgtgattgatagttatatactaaagatgtttgcttagttacgtaattttttcaaaaaaaaaaggtacattatcaatcatcagtcacaaaatattaaaagttactgtttgttttttaaattccatgtcgaatttaattgaatgacacttaaattgggacgaacggtgtaatttcttttgactattctactagtatctatccacagcacgtgttgttcctttcttctttcgtttttcatttacttgacattattaggagacttggccctgaactccaactattctaagctgacctttcttttcctttaccaattatcttcttctttctaatttcgttttacgcgtagtactgcctgaattttctgactttcaacgtttgttattcatgcttgaaaacgaaataccagctaacaaaagatgaattattgtgtttacaagacttgggccgttgactcttactttcccttcctcatcctcacatttagaaaaaagaaatttaacgaaaaattaaaggagatggctgaaattcttctcacagcagtcatcaataaatcaatagaaatagctggaaatgtactctttcaagaaggtacgcgtttatattggttgaaagaggacatcgattggctccagagagaaatgagacacattcgatcatatgtagacaatgcaaaggcaaaggaagttggaggcgattcaagggtgaaaaacttattaaaagatattcaacaactggcaggtgatgtggaggatctattagatgagtttcttccaaaaattcaacaatccaataagttcatttgttgccttaagacggtttcttttgccgatgagtttgctatggagattgagaagataaaaagaagagttgctgatattgaccgtgtaaggacaacttacagcatcacagatacaagtaacaataatgatgattgcattccattggaccggagaagattgttccttcatgctgatgaaacagaggtcatcggtctggaagatgacttcaatacactacaagccaaattacttgatcatgatttgccttatggagttgtttcaatagttggcatgcccggtttgggaaaaacaactcttgccaagaaactttataggcatgtctgtcatcaatttgagtgttcgggactggtctatgtttcacaacagccaagggcgggagaaatcttacatgacatagccaaacaagttggactgacggaagaggaaaggaaagaaaacttggagaacaacctacgatcactcttgaaaataaaaaggtatgttattctcttagatgacatttgggatgttgaaatttgggatgatctaaaacttgtccttcctgaatgtgattcaaaaattggcagtaggataattataacctctcgaaatagtaatgtaggcagatacataggaggggatttctcaatccacgtgttgcaacccctagattcagagaaaagctttgaactctttaccaagaaaatctttaattttgttaatgataattgggccaatgcttcaccagacttggtaaatattggtagatgtatagttgagagatgtggaggtataccgctagcaattgtggtgactgcaggcatgttaagggcaagaggaagaacagaacatgcatggaacagagtacttgagagtatggctcataaaattcaagatggatgtggtaaggtattggctctgagttacaatgatttgcccattgcattaaggccatgtttcttgtactttggtctttaccccgaggaccatgaaattcgtgcttttgatttgacaaatatgtggattgctgagaagctgatagttgtaaatactggcaatgggcgagaggctgaaagtttggcggatgatgtcctaaatgatttggtttcaagaaacttgattcaagttgccaaaaggacatatgatggaagaatttcaagttgtcgcatacatgacttgttacatagtttgtgtgtggacttggctaaggaaagtaacttctttcacacggagcacaatgcatttggtgatcctagcaatgttgctagggtgcgaaggattacattctactctgatgataatgccatgaatgagttcttccatttaaatcctaagcctatgaagcttcgttcacttttctgtttcacaaaagaccgttgcatattttctcaaatggctcatcttaacttcaaattattgcaagtgttggttgtagtcatgtctcaaaagggttatcagcatgttactttccccaaaaaaattgggaacatgagttgcctacgttatgtgcgattggagggggcaattagagtaaaattgccaaatagtattgtcaagctcaaatgtctagagaccctggatatatttcatagctctagtaaacttccttttggtgtttgggagtctaaaatattgagacatctttgttacacagaagaatgttactgtgtctcttttgcaagtccattttgccgaatcatgcctcctaataatctacaaactttgatgtgggtggatgataaattttgtgaaccaagattgttgcaccgattgataaatttaagaacattgtgtataatggatgtatccggttctaccattaagatattatcagcattgagccctgtgcctagagcgttggaggttctgaagctcagatttttcaagaacacgagtgagcaaataaacttgtcgtcccatccaaatattgtcgagttgggtttggttggtttctcagcaatgctcttgaacattgaagcattccctccaaatcttgtcaagcttaatcttgtcggcttgatggtagacggtcatctattggcagtgcttaagaaattgcccaaattaaggatacttatattgctttggtgcagacatgatgcagaaaaaatggatctctctggtgatagctttccgcaacttgaagttttgtatattgaggatgcacaagggttgtctgaagtaacgtgcatggatgatatgagtatgcctaaattgaaaaagctatttcttgtacaaggcccaaacatttccccaattagtctcagggtctcggaacggcttgcaaagttgagaatatcacaggtactataaataattatttacgtttaatatccatgatttttttaaatttgtatttagttcatcaactaaatattccatgtctaataaattgcagggatgcctttgaaaatgattctgtgttggagagaatcttctgatgcctgttggtattataatactaataataagagaaaaagtttgattactgtttcaagttaattgcttgtgatttgtaaaaacaaattacttttatatttctctttgttttattttatgtttatttatctttaattaatggagtaataaaataaaaatcttattttcaatagaaaaaagtagaccttatttgtggtgcatgtatggtatctttttgaaatttttgatatatttgctctttgattcgaatttcttgcttatatgatgatttgcataaatataaaatattatacaaatacctatgggttggaaaatatagaaatatgccaatcaaatgtatacaaaaatcattaatagatagaatcgtaaaagatatacaaatgagaaatgcttgactaagaagcttcgtgcaacctctcacactgagcacaatgcatttggtgatctcggcactattgctgttacttgtaagactacgttccccaataagtctttccaaacggcttgcaaagctgagaatatgaaaatctcataggttagtttgctgcgttaattatttacatttaatatgctcgataaggtgattttaaaaaaatttgtactagttaattcatgaactaaatatttcatttaatactccataattctgaatatggaaaataaataatatttaataacaagaataaaatgataaattattcattgattttataaattggataaatattattaaatattcttaaataatataatgaacaagtgaagatgaacggagggagtatgaagcctcttttcaaag MNYCVYKTWAVDSYFPFLILTFRKKKFNEKLKEMAEILLTAVINKSIEIAGNVLFQEGTRLYWLKEDIDWLQREMRHIRSYVDNAKAKEVGGDSRVKNLLKDIQQLAGDVEDLLDEFLPKIQQSNKFICCLKTVSFADEFAMEIEKIKRRVADIDRVRTTYSITDTSNNNDDCIPLDRRRLFLHADETEVIGLEDDFNTLQAKLLDHDLPYGVVSIVGMPGLGKTTLAKKLYRHVCHQFECSGLVYVSQQPRAGEILHDIAKQVGLTEEERKENLENNLRSLLKIKRYVILLDDIWDVEIWDDLKLVLPECDSKIGSRIIITSRNSNVGRYIGGDFSIHVLQPLDSEKSFELFTKKIFNFVNDNWANASPDLVNIGRCIVERCGGIPLAIVVTAGMLRARGRTEHAWNRVLESMAHKIQDGCGKVLALSYNDLPIALRPCFLYFGLYPEDHEIRAFDLTNMWIAEKLIVVNTGNGREAESLADDVLNDLVSRNLIQVAKRTYDGRISSCRIHDLLHSLCVDLAKESNFFHTEHNAFGDPSNVARVRRITFYSDDNAMNEFFHLNPKPMKLRSLFCFTKDRCIFSQMAHLNFKLLQVLVVVMSQKGYQHVTFPKKIGNMSCLRYVRLEGAIRVKLPNSIVKLKCLETLDIFHSSSKLPFGVWESKILRHLCYTEECYCVSFASPFCRIMPPNNLQTLMWVDDKFCEPRLLHRLINLRTLCIMDVSGSTIKILSALSPVPRALEVLKLRFFKNTSEQINLSSHPNIVELGLVGFSAMLLNIEAFPPNLVKLNLVGLMVDGHLLAVLKKLPKLRILILLWCRHDAEKMDLSGDSFPQLEVLYIEDAQGLSEVTCMDDMSMPKLKKLFLVQGPNISPISLRVSERLAKLRISQVL "PMID: 19348576, 19348577"
Rpi-sto1 Solanum stoloniferum 1 3592 atggctgaagctttcattcaagttctgttagacaatctcacttctttcctcaaaggggaacttacattgcttttcggttttcaagatgagttccaaaggctttcaagcatgttttctacaatccaagccgtccttgaagatgctcaggagaagcaactcaacaacaagcctctagaaaattggttgcaaaaactcaatgctgctacatacgaagtcgatgacatcttggatgaatataaaaccaaggccacaagattctcccagtctgaatatggccgttatcatccaaaggttatccctttccgtcacaaggtcgggaaaaggatggaccaagtgatgaaaaaactaaaggcaattgctgaggaaagaaagaattttcatttgcacgaaaaaattgtagagagacaagctgttagacgggaaacaggtactcatcttaaattagtattacaacaactaagtttatattcatttttttggcaattatcaaattcagaaaagggttaaatatactcatgtcctatcgtaaatagtgtaaatatacctctcgttgtactttcgatctgaatatacttgtcaaatctggcaagctcagaatcaaattatccaccccaacttttaaatactcgacatctttagaaatccacctgtctaactcatccactacccattccctttgctttgaattcttttctttacctataaacttggaacactcgatccgttttgcttttcttaacaaagcagctcagagaaaagaggttttcttctattctgtttctctgtgtgctgcacttgggtccttaatcccattaaaaacagggcatgttaatcccaacgacggtagcctttcctgacagctgactgtaaattttgtctaacaaagaaaaaaaaagattagacatgtttttccttgtcattgattaggctggatttctttcagagtggaacataggggatatattggaccaaaaatagaatgggtatatatttaaagtatttctgatagaacaggagtatattgtgcgaaaatatcctctattttctgttgtctcctaatgagtttgaatgtaataatattctcatgtggacattgcttgcaccaggttctgtattaaccgaaccgcaggtttatggaagagacaaagagaaagatgagatagtgaaaatcctaataaacaatgttagtgatgcccaacacctttcagtcctcccaatacttggtatggggggattaggaaaaacgactcttgcccaaatggtcttcaatgaccagagagttactgagcatttccattccaaaatatggatttgtgtctcggaagattttgatgagaagaggttaataaaggcaattgtagaatctattgaaggaaggccactacttggtgagatggacttggctccacttcaaaagaagcttcaggagttgctgaatggaaaaagatacttgcttgtcttagatgatgtttggaatgaagatcaacagaagtgggcaaatttaagagcagtcttgaaggttggagcaagtggtgcttctgttctaaccactactcgtcttgaaaaggttggatcaattatgggaacattgcaaccatatgaactgtcaaatctgtctcaagaagattgttggttgttgttcatgcaacgtgcatttggacaccaagaagaaataaatccaaaccttgtggcaatcggaaaggagattgtgaaaaaaagtggtggtgtgcctctagcagccaaaactcttggaggtattttgtgcttcaagagagaagaaagagcatgggaacatgtgagagacagtccgatttggaatttgcctcaagatgaaagttctattctgcctgccctgaggcttagttaccatcaacttccacttgatttgaaacaatgctttgcgtattgtgcggtgttcccaaaggatgccaaaatggaaaaagaaaagctaatctctctctggatggcgcatggttttcttttatcaaaaggaaacatggagctagaggatgtgggtgatgaagtatggaaagaattatacttgaggtcttttttccaagagattgaagttaaagatggtaaaacttatttcaagatgcatgatctcatccatgatttggcaacatctctgttttcagcaaacacatcaagcagcaatatccgtgaaataaataaacacagttacacacatatgatgtccattggtttcgccgaagtggtgtttttttacactcttccccccttggaaaagtttatctcgttaagagtgcttaatctaggtgattcgacatttaataagttaccatcttccattggagatctagtacatttaagatacttgaacctgtatggcagtggcatgcgtagtcttccaaagcagttatgcaagcttcaaaatctgcaaactcttgatctacaatattgcaccaagctttgttgtttgccaaaagaaacaagtaaacttggtagtctccgaaatcttttacttgatggtagccagtcattgacttgtatgccaccaaggataggatcattgacatgccttaagactctaggtcaatttgttgttggaaggaagaaaggttatcaacttggtgaactaggaaacctaaatctctatggctcaattaaaatctcgcatcttgagagagtgaagaatgataaggacgcaaaagaagccaatttatctgcaaaagggaatctgcattctttaagcatgagttggaataactttggaccacatatatatgaatcagaagaagttaaagtgcttgaagccctcaaaccacactccaatctgacttctttaaaaatctatggcttcagaggaatccatctcccagagtggatgaatcactcagtattgaaaaatattgtctctattctaattagcaacttcagaaactgctcatgcttaccaccctttggtgatctgccttgtctagaaagtctagagttacactgggggtctgcggatgtggagtatgttgaagaagtggatattgatgttcattctggattccccacaagaataaggtttccatccttgaggaaacttgatatatgggactttggtagtctgaaaggattgctgaaaaaggaaggagaagagcaattccctgtgcttgaagagatgataattcacgagtgcccttttctgaccctttcttctaatcttagggctcttacttccctcagaatttgctataataaagtagctacttcattcccagaagagatgttcaaaaaccttgcaaatctcaaatacttgacaatctctcggtgcaataatctcaaagagctgcctaccagcttggctagtctgaatgctttgaaaagtctaaaaattcaattgtgttgcgcactagagagtctccctgaggaagggctggaaggtttatcttcactcacagagttatttgttgaacactgtaacatgctaaaatgtttaccagagggattgcagcacctaacaaccctcacaagtttaaaaattcggggatgtccacaactgatcaagcggtgtgagaagggaataggagaagactggcacaaaatttctcacattcctaatgtgaatatatataattaa MAEAFIQVLLDNLTSFLKGELTLLFGFQDEFQRLSSMFSTIQAVLEDAQEKQLNNKPLENWLQKLNAATYEVDDILDEYKTKATRFSQSEYGRYHPKVIPFRHKVGKRMDQVMKKLKAIAEERKNFHLHEKIVERQAVRRETGSVLTEPQVYGRDKEKDEIVKILINNVSDAQHLSVLPILGMGGLGKTTLAQMVFNDQRVTEHFHSKIWICVSEDFDEKRLIKAIVESIEGRPLLGEMDLAPLQKKLQELLNGKRYLLVLDDVWNEDQQKWANLRAVLKVGASGASVLTTTRLEKVGSIMGTLQPYELSNLSQEDCWLLFMQRAFGHQEEINPNLVAIGKEIVKKSGGVPLAAKTLGGILCFKREERAWEHVRDSPIWNLPQDESSILPALRLSYHQLPLDLKQCFAYCAVFPKDAKMEKEKLISLWMAHGFLLSKGNMELEDVGDEVWKELYLRSFFQEIEVKDGKTYFKMHDLIHDLATSLFSANTSSSNIREINKHSYTHMMSIGFAEVVFFYTLPPLEKFISLRVLNLGDSTFNKLPSSIGDLVHLRYLNLYGSGMRSLPKQLCKLQNLQTLDLQYCTKLCCLPKETSKLGSLRNLLLDGSQSLTCMPPRIGSLTCLKTLGQFVVGRKKGYQLGELGNLNLYGSIKISHLERVKNDKDAKEANLSAKGNLHSLSMSWNNFGPHIYESEEVKVLEALKPHSNLTSLKIYGFRGIHLPEWMNHSVLKNIVSILISNFRNCSCLPPFGDLPCLESLELHWGSADVEYVEEVDIDVHSGFPTRIRFPSLRKLDIWDFGSLKGLLKKEGEEQFPVLEEMIIHECPFLTLSSNLRALTSLRICYNKVATSFPEEMFKNLANLKYLTISRCNNLKELPTSLASLNALKSLKIQLCCALESLPEEGLEGLSSLTELFVEHCNMLKCLPEGLQHLTTLTSLKIRGCPQLIKRCEKGIGEDWHKISHIPNVNIYN PMID: 18682852
Rpi-pta1 Solanum papita 1 3592 atggctgaagctttcattcaagttctgttagacaatctcacttctttcctcaaaggggaacttacattgcttttcggttttcaagatgagttccaaaggctttcaagcatgttttctacaatccaagccgtccttgaagatgctcaggagaagcaactcaacaacaagcctctagaaaattggttgcaaaaactcaatgctgctacatacgaagtcgatgacatcttggatgaatataaaaccaaggccacaagattctcccagtctgaatatggccgttatcatccaaaggttatccctttccgtcacaaggtcgggaaaaggatggaccaagtgatgaaaaaactaaaggcaattgctgaggaaagaaagaattttcatttgcacgaaaaaattgtagagagacaagctgttagacgggaaacaggtactcatcttaaattagtattacaacaactaagtttatattcatttttttggcaattatcaaattcagaaaagggttaaatatactcatgtcctatcgtaaatagtgtaaatatacctctcgttgtactttcgatctgaatatacttgtcaaatctggcaagctcagaatcaaattatccaccccaacttttaaatactcgacatctttagaaatccacctgtctaactcatccactacccattccctttgctttgaattcttttctttacctataaacttggaacactcgatccgttttgcttttcttaacaaagcagctcagagaaaagaggttttcttctattctgtttctctgtgtgctgcacttgggtccttaatcccattaaaaacagggcatgttaatcccaacgacggtagcctttcctgacagctgactgtaaattttgtctaacaaagaaaaaaaaagattagacatgtttttccttgtcattgattaggctggatttctttcagagtggaacataggggatatattggaccaaaaatagaatgggtatatatttaaagtatttctgatagaacaggagtatattgtgcgaaaatatcctctattttctgttgtctcctaatgagtttgaatgtaataatattctcatgtggacattgcttgcaccaggttctgtattaaccgaaccgcaggtttatggaagagacaaagagaaagatgagatagtgaaaatcctaataaacaatgttagtgatgcccaacacctttcagtcctcccaatacttggtatggggggattaggaaaaacgactcttgcccaaatggtcttcaatgaccagagagttactgagcatttccattccaaaatatggatttgtgtctcggaagattttgatgagaagaggttaataaaggcaattgtagaatctattgaaggaaggccactacttggtgagatggacttggctccacttcaaaagaagcttcaggagttgctgaatggaaaaagatacttgcttgtcttagatgatgtttggaatgaagatcaacagaagtgggctaatttaagagcagtcttgaaggttggagcaagtggtgcttctgttctaaccactactcgtcttgaaaaggttggatcaattatgggaacattgcaaccatatgaactgtcaaatctgtctcaagaagattgttggttgttgttcatgcaacgtgcatttggacaccaagaagaaataaatccaaaccttgtggcaatcggaaaggagattgtgaaaaaaagtggtggtgtgcctctagcagccaaaactcttggaggtattttgtgcttcaagagagaagaaagagcatgggaacatgtgagagacagtccgatttggaatttgcctcaagatgaaagttctattctgcctgccctgaggcttagttaccatcaacttccacttgatttgaaacaatgctttgcgtattgtgcggtgttcccaaaggatgccaaaatggaaaaagaaaagctaatctctctctggatggcgcatggttttcttttatcaaaaggaaacatggagctagaggatgtgggcgatgaagtatggaaagaattatacttgaggtcttttttccaagagattgaagttaaagatggtaaaacttatttcaagatgcatgatctcatccatgatttggcaacatctctgttttcagcaaacacatcaagcagcaatatccgtgaaataaataaacacagttacacacatatgatgtccattggtttcgccgaagtggtgtttttttacactcttccccccttggaaaagtttatctcgttaagagtgcttaatctaggtgattcgacatttaataagttaccatcttccattggagatctagtacatttaagatacttgaacctgtatggcagtggcatgcgtagtcttccaaagcagttatgcaagcttcaaaatctgcaaactcttgatctacaatattgcaccaagctttgttgtttgccaaaagaaacaagtaaacttggtagtctccgaaatcttttacttgatggtagccagtcattgacttgtatgccaccaaggataggatcattgacatgccttaagactctaggtcaatttgttgttggaaggaagaaaggttatcaacttggtgaactaggaaacctaaatctctatggctcaattaaaatctcgcatcttgagagagtgaagaatgatagggacgcaaaagaagccaatttatctgcaaaagggaatctgcattctttaagcatgagttggaataactttggaccacatatatatgaatcagaagaagttaaagtgcttgaagccctcaaaccacactccaatctgacttctttaaaaatctatggcttcagaggaatccatctcccagagtggatgaatcactcagtattgaaaaatattgtctctattctaattagcaacttcagaaactgctcatgcttaccaccctttggtgatctgccttgtctagaaagtctagagttacactgggggtctgcggatgtggagtatgttgaagaagtggatattgatgttcattctggattccccacaagaataaggtttccatccttgaggaaacttgatatatgggactttggtagtctgaaaggattgctgaaaaaggaaggagaagagcaattccctgtgcttgaagagctgataattcacgagtgcccttttctgaccctttcttctaatcttagggctcttacttccctcagaatttgctataataaagtagctacttcattcccagaagagatgttcaaaaaccttgcaaatctcaaatacttgacaatctctcggtgcaataatctcaaagagctgcctaccagcttggctagtctgaatgctttgaaaagtctaaaaattcaattgtgttgcgcactagagagtctccctgaggaagggctggaaggtttatcttcactcacagagttatttgttgaacactgtaacatgctaaaatgtttaccagagggattgcagcacctaacaaccctcacaagtttaaaaattcggggatgtccacaactgatcaagcggtgtgagaagggaataggagaagactggcacaaaatttctcacattcctaatgtgaatatatataattaa MAEAFIQVLLDNLTSFLKGELTLLFGFQDEFQRLSSMFSTIQAVLEDAQEKQLNNKPLENWLQKLNAATYEVDDILDEYKTKATRFSQSEYGRYHPKVIPFRHKVGKRMDQVMKKLKAIAEERKNFHLHEKIVERQAVRRETGSVLTEPQVYGRDKEKDEIVKILINNVSDAQHLSVLPILGMGGLGKTTLAQMVFNDQRVTEHFHSKIWICVSEDFDEKRLIKAIVESIEGRPLLGEMDLAPLQKKLQELLNGKRYLLVLDDVWNEDQQKWANLRAVLKVGASGASVLTTTRLEKVGSIMGTLQPYELSNLSQEDCWLLFMQRAFGHQEEINPNLVAIGKEIVKKSGGVPLAAKTLGGILCFKREERAWEHVRDSPIWNLPQDESSILPALRLSYHQLPLDLKQCFAYCAVFPKDAKMEKEKLISLWMAHGFLLSKGNMELEDVGDEVWKELYLRSFFQEIEVKDGKTYFKMHDLIHDLATSLFSANTSSSNIREINKHSYTHMMSIGFAEVVFFYTLPPLEKFISLRVLNLGDSTFNKLPSSIGDLVHLRYLNLYGSGMRSLPKQLCKLQNLQTLDLQYCTKLCCLPKETSKLGSLRNLLLDGSQSLTCMPPRIGSLTCLKTLGQFVVGRKKGYQLGELGNLNLYGSIKISHLERVKNDRDAKEANLSAKGNLHSLSMSWNNFGPHIYESEEVKVLEALKPHSNLTSLKIYGFRGIHLPEWMNHSVLKNIVSILISNFRNCSCLPPFGDLPCLESLELHWGSADVEYVEEVDIDVHSGFPTRIRFPSLRKLDIWDFGSLKGLLKKEGEEQFPVLEELIIHECPFLTLSSNLRALTSLRICYNKVATSFPEEMFKNLANLKYLTISRCNNLKELPTSLASLNALKSLKIQLCCALESLPEEGLEGLSSLTELFVEHCNMLKCLPEGLQHLTTLTSLKIRGCPQLIKRCEKGIGEDWHKISHIPNVNIYN PMID: 18682852
R2 Solanum demissum 1 2538 atggctgatgcctttctatcatttgcagttcaaaaattgggtgatttcctcattcaacaagtttctctgcgtaaaaatctgagaaaggaaattgagtggctgagaaatgagctactcttcatacagtctttcctcagagatgcagaactaaagcaatatggagatcaaagagttcaacaatgggtgtttgagatcaactctattgctaatgatgttgttgctatactcgagacttacaccttcgaggctggtaaaggtgctagtcgtctcaaggcttgcgcttgcatatatacgaaggagaagaaattctacaatgttgccgaggagatccaatcactcaagcaacgaatcatggatatctctcgcaaacgagagacttatggtattacaaatatcaataataattcaggagaagggccaagtaatcaggttagaacattgaggagaactacctcatatgtggatgaccaggattacatttttgttggacttcaggatgttgtacaaaaattgctagctcaacttctcaaagcagagccccgtcgaaccgtcctctccattcatggcatgggcggattgggcaagaccactcttgcgagaaaactttacaacagttctgctatactcaatagcttccctacacgcgcttggatatgtgtctctcaagagtacaacacaatggatcttcttaggaatatcataaaatccgtccaaggtcgcaccaaggaaactctagatttgttggaaaggatgacagaaggagatctagaaatctatcttcgtgatctattaaaagaacgcaaataccttgtgatggttgatgatgtatggcagaaagaagcatgggatagtttgaagagagcattcccggatagcaagaatggcagcagagtcattattaccacgcgcaaacaggatgtcgctgaaagagcagacgacataggttttgttcataaacttcgtttcctaagtcaagaagaaagttgggatctctttcgtaagaaactacttgatgttcgatcaatggttccagaaatggaaaatctagctaaggatatggtggaaaagtgtagaggcttacctcttgcaattgttgtattgagcggactactttcgcataaaaaggggctaaaccaatggcaaaaggtgaaagatcacctttggaagaacattaaagaagataaatctattgaaatctctaacatactatccttaagctacaatgatttgtcaactgcgctcaagcagtgttttctctactttggtatttttccagaagatcaagtggtaaaggctgatgacataatacggttgtggatggcggagggtttcatacccagaggagaagaaagaatggaggatgtggctgacggcttcttgaatgaactgataagacgaagcttggttcaagtagctaaaacattttgggaaaaagttactgactgtagggttcatgatttacttcgtgatcttgcgatacaaaaggtattggaggtaaacttctttgacatttatgatccaagaagccactccatatcctctttatgtatcagacatggcattcatagtgaaggagaaaggtacctctcatcacttgatctttctaacttgaagttgaggtcaattatgttcttcgatccatatatttgtaatgtgttccaacatatagatgtgtttcgacatctatatgtgttgtacttggatacgaattttgggtatgtgtctatggtacctgatgccataggaagtttgtaccacctcaagttgttaagattgagaggtatccatgatattccgtcttccattggcaacctcaagaatttacaaacacttgtcgttgtaaatggttacacatttttttgcgaactaccctgcaagacagctgacctaataaatctaagacatttagttgttcaatatacagagcctttaaaatgtataaacaaactcactagtcttcaagttcttgatggtgttgcttgtgatcagtggaaagatgttgaccctgttgatttagtcaatcttcgagaattaagcatggatcgtatcaggagctcttactccctaaacaacattagcagcttgaaaaaccttagcactctcaaattgatttgtggagaacgtcaatcatttgcatcccttgaatttgttaattgttgtgaaaagctccagaaattgtggttacaagggagaatagaggaactgcctcatctgttttcaaactccatcacaatgatggttctgagtttctcagaactgacagaagatccgatgcctattttgggaaggtttccaaacctaaggaatctcaaattagatggagcttacgaaggaaaagaaataatgtgcagtgataacagcttcagtcaactagagttccttcatcttcgtgatctttggaagctagaaagatgggatttaggcacaagtgccatgcctctgattaaaggtcttggtatccataactgtccaaatttaaaggagattcctgagagaatgaaagacgtggagctgttgaagcggaattatatgttgtga MADAFLSFAVQKLGDFLIQQVSLRKNLRKEIEWLRNELLFIQSFLRDAELKQYGDQRVQQWVFEINSIANDVVAILETYTFEAGKGASRLKACACIYTKEKKFYNVAEEIQSLKQRIMDISRKRETYGITNINNNSGEGPSNQVRTLRRTTSYVDDQDYIFVGLQDVVQKLLAQLLKAEPRRTVLSIHGMGGLGKTTLARKLYNSSAILNSFPTRAWICVSQEYNTMDLLRNIIKSVQGRTKETLDLLERMTEGDLEIYLRDLLKERKYLVMVDDVWQKEAWDSLKRAFPDSKNGSRVIITTRKQDVAERADDIGFVHKLRFLSQEESWDLFRKKLLDVRSMVPEMENLAKDMVEKCRGLPLAIVVLSGLLSHKKGLNQWQKVKDHLWKNIKEDKSIEISNILSLSYNDLSTALKQCFLYFGIFPEDQVVKADDIIRLWMAEGFIPRGEERMEDVADGFLNELIRRSLVQVAKTFWEKVTDCRVHDLLRDLAIQKVLEVNFFDIYDPRSHSISSLCIRHGIHSEGERYLSSLDLSNLKLRSIMFFDPYICNVFQHIDVFRHLYVLYLDTNFGYVSMVPDAIGSLYHLKLLRLRGIHDIPSSIGNLKNLQTLVVVNGYTFFCELPCKTADLINLRHLVVQYTEPLKCINKLTSLQVLDGVACDQWKDVDPVDLVNLRELSMDRIRSSYSLNNISSLKNLSTLKLICGERQSFASLEFVNCCEKLQKLWLQGRIEELPHLFSNSITMMVLSFSELTEDPMPILGRFPNLRNLKLDGAYEGKEIMCSDNSFSQLEFLHLRDLWKLERWDLGTSAMPLIKGLGIHNCPNLKEIPERMKDVELLKRNYML PMID: 19445588
Rpi-blb3 Solanum bulbocastanum 2939 5482 aaaacggattcggggagtgaaaagcttaccgttagcctcaagaacgatggaaaactatcaagagtcgtctggggttcgttccttagctctaaaaatcgaaaagtgcagaataaagacgttttgaggcttatttacgcactacaaaaaaatcatatattgctgcaaaatttgttgtagctaaatatgaaaatttccatggctaaacttcaatattttcttccttagcattcgtagcaagatatagcatggctaaaagttagctacaaactttacatggttcatggctgagaactaatatctattgctacaaaatttttgagttgtagctgtactgataaaaagtttttgccacacaaaatatatatatatatatagcaaataactttattcttttgccacgtcaaaaatgatttatagttgtctttttagatgcagccacaaagctattacattgtagcaacatatttaatttggtttccatgtaaacagaaatttgtagctatttgtatagcttagtcacgtggcaatagtactcgtatttagttatgactattaaaattcatggcaataacatgaagtatttaccacaagcattttcgaattatagctaaaattcatatctttagccatgaatatatataattttagctaaaaatccatttgctacgaaagtcaaaatttatatacatgtttttttacgtgatatatatagaaaatttgttgcattcaatatataattccattattattagagattttttcgcaagctttattagttccaagagctacataatgtagctatgaattaatttttaagatttcaaaacacttcctaaattacgtataattacaatttacaattttaaaaatagttctaattatatataactcatgtaatacactatcttgtttgagtacaaagcagtatagtcttctcttatttctccttccacaacgttcaattgaatcttagcttgatttacaccgatcttgtcatttagatgctttaactccattgatatacctatcaaaatgatgaagtatttcaacaccaacaatcattaccaactaattatagatgagagtgtgtgttatataatatttcaagaagacaacaaatttatttatatatatatcattagctaaaaaatttgaaagatacaaacaaaaatatgcaagaaaaaaaagtaaacaaatctataaacttttatttcttaaaataatgttcacctcaattgtgacatttttggcggtttgcgaattatgactcctctcaacactatttaaattttaaaatcttcacaatctgctcataaataagatgtaatattttttaaaagatctaaaataatctaaacccaaaaatctaagtcaaataagtgaaacataaattcgaaaattgtaaataagaagatatgaacatgccttgaatataaaaaaaccacaaaaagaaattagcaaaacattctacattttgaaatgccaaagtcttctctctcaacatttatctcttgagcaagaagatttccatgtaaacttcatgtcctttactttaagcattacttccgatattgttcttacctttgtcaaggaacctagtccattgacctatggtggacacagataagctaacaacatttaataccctaactaccattaccacaacaggtagagtacgctgaatttttctaagttgtgtcaccatttaaaggacaaaaatgactcaagagtaaaatcaatgaagcatttgctgcaggcctccaaaagttttatcgatatatttttttttaataatttgctcgttcttccaaatcagttgaaacttgagttgttaaaattgatttggtacgtctggattttttttcaaataataccgctccatcaaatttagattaatatgatgtaatatgcacaattagaattgcggacaattgtaaccaatttaatgaattcaaaattatttcattgtaacaagcaaatagtaaaaaataaaattattattatgaacaaataaaaagggacaaggcataagtactctcctagactatgactgaaatctcagaaacacacataaacttaactagggtcctattaccccctaaactaatttaaaatggaataaatacaccacaaacggtgacatgacatagagagtgtacacactctattgaaggcaattgattagtgcacaaattggacacatgtcatttttttattgataactttattattagttagtacacatatttattgataataaaaattatatatatataattatttttatttctttctttgtaaaatatttattttaatttctttttactttaaacttttttttatttaatttattatgttttcacttttgattatttaaaaaaaatttatgtgtattttttaaaaaagtaattttaaagtgtcctttaattttaatgttttaacttttttatgttttatttgaatttcttcacttattttaatatccgttcaatttaatgaatcctaaattatttcattgtaacaagtaaatagaaaaaaataaaataagtcttatgaagaaataaaaacaaatatattttttccacaagttgtgtaatgattgttgaagatgcttccattttttaaatcttttctcaatatatattttccacaagttgtgcaatgattgctgaagttgctttattgttttaagacttttctctatatgtgtttttccccaagttgtataatggttgttgaagatgctttaattaaaaaaaaaaaccttttgtttagtggaaaatttcaaaaagctttagtacatctttgtcgttttatccaatcgtaattctttattcagaaaccacatgttttttttctaatcttacttttatgtctatcacccattttccaatatacagcctactctttttttcaatcaaaactagtattcctaaagatggctgatgcctttctatcatttgcagttcaaaaattgggtgatttcctaatacagaaagtttccctgcgtaaaagtctcagagatgaaattagatggctgataaatgagctactcttcatacggtctttcctcagagatgcagaacaaaagcagtgcggagatcaaagagttcaacaatgggtgtttgagatcaactctattgctaatgatgctgttgctatactcgagacttatagctttgaggctggtaaaggtgctagtcgtctcaaggcttgcacttgcatatgtaggaaggagaagaaattctacaatgttgccgaggagattcaatcactcaagcaacgaatcatggatatctctcgcaaacgagagacttatggtattacaaatatcaattataattcaggagaaaggccaagtaatcaggttacaacattgaggagaactacctcatatgtagatgaacaggattacatttttgttggctttcaggatgttgtacaaacattgctagctcaacttctgaaagcagagcctcgtcgaagcgtcctctccatttatggaatggggggtttaggcaagaccactcttgccagaaaactttacaccagtcctgatatactcaatagctttcctacacgcgcttggatatgtgtctctcaagagtacaacacaatggatcttcttaggactatcataaaatccatccaaggctgcgccaaggaaactctagatttgttggaaaagatggcagaaatagatctagaaaatcaccttcgtgatctattgaaagaatgcaaataccttgtggtggttgatgatgtatggcagagagaagcatgggagagtttgaaaagagcattcccggatggcaagaatggaagcagagtcattattaccacgcgcaaagaggatgtcgctgaaagagtagaccacagaggttttgttcataaacttcgtttcctaagtcaagaagaaagttgggatctctttcgtaggaaactacttgatgttcgagcaatggttccagaaatggaaagtttagctaaggatatggtggaaaagtgtagaggcttacctcttgcaattgttgtattgagcggactactttcgcataaaaaggggctaaaccaatggcaaaaggtgaaagatcacctttggaagaacattaaagaagataaatctattgaaatctctaacatactatccttaagctacaatgatttgtcaactgcgctcaagcagtgttttctctactttggtatttttccagaagatcaagtggtaaaggctgatgacataatacggttgtggatggcggagggtttcatacccagaggagaagaaagaatggaggatgtggctgacggcttcttgaatgaactgataagacgaagcttggttcaagtagctaaaacattttgggaaaaagttactgactgtagggttcatgatttacttcgtgatcttgcgatacaaaaggcattggaggtaaacttctttgacgtttatggtccaagaagccactccatatcctctttatgtatcagacatggcattcatagtgaaggagaaaggtacctctcatcacttgatctttctaacttgaagttgaggtcaattatgttcttcgatccagattttcgtaagatgagtcatataaacctcaggagtgagttccaacatctgtatgtgttgtacttggatacgaattttgggtatgtgtctatggtacctgatgccataggaagtttgtaccacctcaagttgttaagattgagaggtatccatgatattccgtcttccattggcaacctcaagaatttacaaacacttgtcgttgtaaatggttacacatttttttgccaactaccctgcaagacagctgacctaataaatctaagacatttagttgttcaatattcagagcctttaaaatgtataaacaaactcactagtcttcaagttcttgatggtgttgcttgtgatcagtggaaagatgttgaccctgttgatttagtcaatcttcgagaattaagcatggatcgtatcaggagctcttactccctaaacaacattagcagcttgaaaaaccttagcactctcaaattgatttgtggagaacgtcaatcatttgcatcccttgaatttgttaattgttgtgaaaagctccagaaattgtggttacaagggagaatagaggaactgcctcatctgttttcaaactccatcacaatgatggttctgagtttctcagaactgacagaagatccgatgcctattttgggaaggtttccaaacctaaggaatctcaaattagatggagcttatgaaggaaaagaaataatgtgcagtgataacagcttcagtcaactagagttccttcatcttcgtgatctttggaagctagaaagatgggatttaggcacaagtgccatgcctctgattaaaggtcttggtatccataactgtccaaatttaaaggagattcctgagagaatgaaagacatggagctgttgaagcggaattatatgttgtgaagcttttctgccaagcacattggttattaattgagtggttttagtgttgatttcttattattgttttaagctttttgagtgtgtaattggtttgaacattattgttttaattaattggtctactgtatgttctcatgcttatccacatttaagacaatgctttatatgttaaaatgaaattaaaaatactagtatatggtactctctcttgtccacaatttcgtatattttttgttcctcttcataaaaaaaatggtaaaaaataccattaaactatgtgataggaacaaaaatgtcttctattataatttaacttaaaaatgtctttactgtcagtaccttagttcaaaattgccctcgagtccgtagttacaaaatgtcctttttcgaataaatatatatatttttttaaacacatcttcttcctaattaaaatattattaaagaagactattcttgttttcttttttctaaaaatcactttaacaaataaaaatgtaggaaatattttgttttcttcttaatctcactttatcaattaaaatagaataactccatgtaccctttcgacatataatatatgtcatatatatatataagatcatagtatatgcatcattaatttatatttatataacgataaaaaataatgataataaaataagaaatatttttattttttattttcttctgaattgaagtaatataaacatttgctaattttaaaaaaaaataatacaaaaataatgtgttaaaaagaaaataataatatatttatttggaaaatgagtatttttgatccattaaataacagtaagtgtatttttagaccaaagtattgacaacaagggtatttttggatcaaacgacaaacggagggtacttttgctcctttcgcataatttaagggtatttttaaaccaaaatattgacggtaaaggcatttttgagtcaaattatgaacgaaagacatttttatttctttcacatagtttaaggacatttttgacccatttccctcctttatataaataatatttatgttaaatcaacagagaagaagctgtcaattgaagacattcactttcatcaacttggcttctccaagcatcaatcaacttggattatttcaacattctgttttttcaatgtttaatttctttctatttttggaaacatgtgttggaagagaaccttttttctggattttgtgatgacctaattaacgaaacaaagttaaaaatgttcttaaattatgtaaaatgaataaaaatatcctcagttaatagtttgatccaaaaatattgttgtctctaataattgatctaaaaatgatattattgttacttaataagtgaaaaccgtctttttttcaattaaatatattatttttctttttttaaaacacgctcttttcctaataatgattttttttcattaaaaaatattcatcctacttcaatttataaaaaatattactaataaataaaaatgttttttatattattagaaagttttttatcgttatttaaatgaaaattaatgacggggttactatgaggacatataatggaagaagttgagaactcgcttagtgtgaagcgagaataactaaaaaaaaaaaaaaaacttacaaactcgcttggtgcggagcgatttttgggggaaaatagagagcaaatcgctcataggtagcgagaaaaaaaagataaaataaaagagaaaatcgctcgtaagtcaacaagatgatcaatttttttatgccgttaacgatagttatagcacaaacatatctcgctccttctctagcaaagtgtcccttttgattaaaccaaaaattgaaagaccctttatgtattttaaagaaaaaaagtgatgtttttaactttgaattcgaaatttaatcatcccaatataattcataaacgaatttttacatcaattttaaaataaagaataaaaaaaagaaagataatatatactagcagggaactacatgtgattactacaaaagataaattcaatttcaggtggtatttggatttgaattgtcttaccttgctatcataacattatttttgtttttatccattaaaaaaatgatgcatttatatatttattactagtaaagtaatatctttaatgtgtcaacacataagtatccctcaattagtaaaatgttaggacttttttcatgtgagaaacccaacctcattgaaaaaggaaattaatacattttaactcaacttttaattaattaatgtcaagtttgataaaaataaataaaaaaacaatcgtagacaatctctaattattagaattttacaatatgcatatttaatgggttatataaattttgagttggccttctttttttcttcttgtgattctaagtcctccactttatttttatttttatatttataattaaatattttttactcgattcacagaccgagttggaccagtccaatcttgattaagcctcacgagttgacgagcttatttaggcttggctaaataatttcgttcttaaatgaacttttaattttttttgagctcaatcctatcaaatcgcagattaggttggatttgggtgaaacaatggaccaaagtccaaactaacagctccaaaatctacgaggtttagaaatagaaagtcttcttatatgttatgtatatctaacaaattatatgttatgtatgatattgtataaatagttatttaatgtatcaatattgtataataacatatagttatgtatttataatgtataactatatatgatattgtataaatagttatttaatgtatcgatattgtatagtagcatatagttatgtatttataatgtatgtataactatgtatgatattgtataaatagattttggacttgggaagtctgcagcaagcaaaggaagaggtccaggtagcaacacttttatcttaatgaatacaccaaatgatgatc MADAFLSFAVQKLGDFLIQKVSLRKSLRDEIRWLINELLFIRSFLRDAEQKQCGDQRVQQWVFEINSIANDAVAILETYSFEAGKGASRLKACTCICRKEKKFYNVAEEIQSLKQRIMDISRKRETYGITNINYNSGERPSNQVTTLRRTTSYVDEQDYIFVGFQDVVQTLLAQLLKAEPRRSVLSIYGMGGLGKTTLARKLYTSPDILNSFPTRAWICVSQEYNTMDLLRTIIKSIQGCAKETLDLLEKMAEIDLENHLRDLLKECKYLVVVDDVWQREAWESLKRAFPDGKNGSRVIITTRKEDVAERVDHRGFVHKLRFLSQEESWDLFRRKLLDVRAMVPEMESLAKDMVEKCRGLPLAIVVLSGLLSHKKGLNQWQKVKDHLWKNIKEDKSIEISNILSLSYNDLSTALKQCFLYFGIFPEDQVVKADDIIRLWMAEGFIPRGEERMEDVADGFLNELIRRSLVQVAKTFWEKVTDCRVHDLLRDLAIQKALEVNFFDVYGPRSHSISSLCIRHGIHSEGERYLSSLDLSNLKLRSIMFFDPDFRKMSHINLRSEFQHLYVLYLDTNFGYVSMVPDAIGSLYHLKLLRLRGIHDIPSSIGNLKNLQTLVVVNGYTFFCQLPCKTADLINLRHLVVQYSEPLKCINKLTSLQVLDGVACDQWKDVDPVDLVNLRELSMDRIRSSYSLNNISSLKNLSTLKLICGERQSFASLEFVNCCEKLQKLWLQGRIEELPHLFSNSITMMVLSFSELTEDPMPILGRFPNLRNLKLDGAYEGKEIMCSDNSFSQLEFLHLRDLWKLERWDLGTSAMPLIKGLGIHNCPNLKEIPERMKDMELLKRNYML PMID: 19445588
Rpi-abpt1 Solanum sp 1 2538 atggctgatgcctttctatcatttgcagttcaaaaattgggtgatttcctaatacagaaagtttccctgcgtaaaagtctcagagacgaaattagatggctgatcaatgagctactcttcatacggtctttcctcagagatgcagaacaaaagcagtgcggagatcaaagagttcaacaatgggtgtttgagatcaactctattgctaatgatgctgttgctatactcgagacttatagctttgaggctggtaaaggtgctagtcgtctcaaggcttgcacttgcatatgtaggaaggagaagaaattctacaatgttgccgaggagattcaatcactcaagcaacgaatcatggatatctctcgcaaacgagagacttatggtattacaaatatcaataataatgcaggagaagggccaagtaatcaggttacaaaattgaggagaactacctcatatgtagatgaacaggattacatttttgttggctttcaggatgttgtacaaacatttctagctcaacttctgaaagcagagcctcgtcgaagcgtcctctccatttatggaatggggggtttaggcaagaccactcttgccagaaaactttacaccagtcctgatatactcaatagcttccgtacacgcgcttggatatgtgtctctcaagagtacaacacaatggatcttcttaggaatatcataaaatccatccaaggtcgcaccaaggaaactctagatttgttggaaaggatgacagaaggagatcttgaaatttatcttcgtgatttattgaaagaacgcaaataccttgtggtggttgatgatgtatggcagagagaagcatgggagagtttgaaaagatcattcccggatggcaagaatggcagcagagtcattattaccacgcgcaaagaggatgtcgctgaaagagcagacgacagaggttttgttcataaacttcgtttcctaagccaagaagaaagttgggatctctttcgtaggaaactacttgatgttcgagcaatggttccagaaatggaaagtctagctaaggatatggtggaaaagtgtagaggcttacctcttgcaattgttgtattgagcggactactttcgcataaaaaggggctaaaccaatggcaaaaggtgaaagatcacctttggaagaacattaaagaagataaatctattgaaatctctaacatactatccttaagctacaatgatttgtcaactgcgctcaagcagtgttttctctactttggtatttttccagaagatcaagtggtaaaggctgatgacataatacggttgtggatggcggagggtttcatacccagaggagaagaaagaatggaggatgtggctgacggcttcttgaatgaactgataagacgaagcttggttcaagtagctaaaacattttgggaaaaagttactgactgtagggttcatgatttacttcgtgatcttgcgatacaaaaggcattggaggtaaacttctttgacatttatgatccaagaagccactccatatcctctttatgtatcagacatggcattcatagtgaaggagaaaggtacctctcatcacttgatctttctaacttgaagttgaggtcaattatgttcttcgatccatatatttgtaatgtgttccaacatatagatgtgtttcgacatctatatgtgttgtacttggatacgaattttgggtatgtgtctatggtacctgatgccataggaagtttgtaccacctcaagttgttaagattgagaggtatccatgatattccgtcttccattggcaacctcaagaatttacaaacacttgtcgttgtaaatggttacacatttttttgcgaactaccctgcaagacagctgacctaataaatctaagacatttagttgttcaatatacagagcctttaaaatgtataaacaaactcactagtcttcaagttcttgatggtgttgcttgtgatcagtggaaagatgttgaccctgttgatttagtcaatcttcgagaattaagcatggatcgtatcaggagctcttactccctaaacaacattagcagcttgaaaaaccttagcactctcaaattgatttgtggagaacgtcaatcatttgcatcccttgaatttgttaattgttgtgaaaagctccagaaattgtggttacaagggagaatagaggaactgcctcatctgttttcaaactccatcacaatgatggttctgagtttctcagaactgacagaagatccgatgcctattttgggaaggtttccaaacctaaggaatctcaaattagatggagcttacgaaggaaaagaaataatgtgcagtgataacagcttcagtcaactagagttccttcatcttcgtgatctttggaagctagaaagatgggatttaggcacaagtgccatgcctctgattaaaggtcttggtatccataactgtccaaatttaaaggagattcctgagagaatgaaagacgtggagctgttgaagcggaattatatgttgtga MADAFLSFAVQKLGDFLIQKVSLRKSLRDEIRWLINELLFIRSFLRDAEQKQCGDQRVQQWVFEINSIANDAVAILETYSFEAGKGASRLKACTCICRKEKKFYNVAEEIQSLKQRIMDISRKRETYGITNINNNAGEGPSNQVTKLRRTTSYVDEQDYIFVGFQDVVQTFLAQLLKAEPRRSVLSIYGMGGLGKTTLARKLYTSPDILNSFRTRAWICVSQEYNTMDLLRNIIKSIQGRTKETLDLLERMTEGDLEIYLRDLLKERKYLVVVDDVWQREAWESLKRSFPDGKNGSRVIITTRKEDVAERADDRGFVHKLRFLSQEESWDLFRRKLLDVRAMVPEMESLAKDMVEKCRGLPLAIVVLSGLLSHKKGLNQWQKVKDHLWKNIKEDKSIEISNILSLSYNDLSTALKQCFLYFGIFPEDQVVKADDIIRLWMAEGFIPRGEERMEDVADGFLNELIRRSLVQVAKTFWEKVTDCRVHDLLRDLAIQKALEVNFFDIYDPRSHSISSLCIRHGIHSEGERYLSSLDLSNLKLRSIMFFDPYICNVFQHIDVFRHLYVLYLDTNFGYVSMVPDAIGSLYHLKLLRLRGIHDIPSSIGNLKNLQTLVVVNGYTFFCELPCKTADLINLRHLVVQYTEPLKCINKLTSLQVLDGVACDQWKDVDPVDLVNLRELSMDRIRSSYSLNNISSLKNLSTLKLICGERQSFASLEFVNCCEKLQKLWLQGRIEELPHLFSNSITMMVLSFSELTEDPMPILGRFPNLRNLKLDGAYEGKEIMCSDNSFSQLEFLHLRDLWKLERWDLGTSAMPLIKGLGIHNCPNLKEIPERMKDVELLKRNYML PMID: 19445588

Latest revision as of 10:39, 25 April 2013

More info at Reference R-Genes, manually curated

  Gene name Has Description Species
PRGDB00000029 Asc-1 Lycopersicon esculentum ASC1 (Asc) gene, Asc-1 allele, complete cds. Solanum lycopersicum
PRGDB00000030 Bs2 Capsicum chacoense disease resistance protein BS2 (BS2) mRNA, complete cds. Capsicum chacoense
PRGDB00000031 Bs4 Lycopersicon esculentum bacterial spot disease resistance protein 4 (Bs4) gene, Bs4-MM allele, complete cds. Solanum lycopersicum
PRGDB00000032 Cf-2 Lycopersicon pimpinellifolium leucine rich repeat protein Cf-2.1 gene, complete cds. Solanum pimpinellifolium
PRGDB00000033 Cf-4 Lycopersicon hirsutum Cf-4 resistance gene cluster. Solanum habrochaites
PRGDB00000034 Cf4A Lycopersicon hirsutum Cf-4 resistance gene cluster. Solanum habrochaites
PRGDB00000035 Cf-5 Lycopersicon esculentum disease resistance protein (Cf-5) gene, complete cds. Solanum lycopersicum var. cerasiforme
PRGDB00000036 Cf-9 Lycopersicon pimpinellifolium Cf-9 resistance gene cluster. Solanum pimpinellifolium
PRGDB00000037 Cf9B Lycopersicon pimpinellifolium Cf-9 resistance gene cluster. Solanum pimpinellifolium
PRGDB00000038 Gpa2 Solanum tuberosum disease resistance protein Gpa2 gene, complete cds. Solanum tuberosum
PRGDB00000039 Gro1.4 Solanum tuberosum nematode resistance protein (Gro1-4) gene, Gro1-4-P40 allele, complete cds. Solanum tuberosum
PRGDB00000040 Hero Lycopersicon esculentum hero gene for hero resistance protein, exons 2-3. Solanum lycopersicum
PRGDB00000041 I-2 Lycopersicon esculentum disease resistance protein I2 (I2) gene, complete cds. Solanum lycopersicum
PRGDB00000042 Mi1.2 Lycopersicon esculentum root-knot nematode resistance protein (Mi-1.2) mRNA, complete cds. Solanum lycopersicum
PRGDB00000043 Pto Lycopersicon pimpinellifolium Rio Grande-PtoR protein kinase mRNA, complete cds. Solanum pimpinellifolium
PRGDB00000044 N Nicotiana glutinosa virus resistance (N) gene, complete cds. Nicotiana glutinosa
PRGDB00000045 Prf Lycopersicon pimpinellifolium Rio Grande 76R Pto locus, complete sequence. Solanum pimpinellifolium
PRGDB00000046 R1 Solanum demissum late blight resistance protein (R1) gene, complete cds. Solanum demissum
PRGDB00000047 R3a Solanum tuberosum potato late blight resistance protein R3a gene, complete cds. Solanum tuberosum
PRGDB00000048 Rpi-blb1 Solanum bulbocastanum putative disease resistant protein RGA2 gene, complete cds. Solanum bulbocastanum
PRGDB00000049 Rpi-blb2 Solanum bulbocastanum late blight resistance protein Rpi-blb2 (Rpi-blb2) gene, complete cds. Solanum bulbocastanum
PRGDB00000050 Rx Solanum tuberosum rx gene. Solanum tuberosum
PRGDB00000051 Rx2 Solanum acaule Rx2.ac15 gene for NBS-LRR protein, exons 1-3. Solanum acaule
PRGDB00000052 RY-1 Solanum tuberosum subsp. andigena ry-1 gene for resistance gene-like, exons 1-6, splice variants C38 and C19. Solanum tuberosum subsp. andigena
PRGDB00000053 Sw-5 Lycopersicon esculentum tospovirus resistance protein A (Sw5-a) and tospovirus resistance protein B (Sw5-b) genes, complete cds. Solanum lycopersicum
… further results

Pages in category "Reference R-Genes, manually curated"

The following 112 pages are in this category, out of 112 total.


P cont.

P cont.

Personal tools
