Category:Reference R-Genes, manually curated

From PRG Wiki
Revision as of 10:36, 25 April 2013 by JackVossen (Talk | contribs)

Jump to: navigation, search

Name Genbank_locus Species Location Start End DNA Prot Comment R3b NFSFS Solanum demissum 1 3852 atggaaattggcttagcagttggtggtgcatttctctcttcagctttgaatgttctctttgacaggcttgctcctaatagtgatctgttgaagatgtttaagagggacaagcgtgatgttcggctcttaaagaagctgaggatgactttgcttggccttcaggctgtgttaagtgatgcggagaataagcaagcatcaaatccatacgtgagccagtggcttaatgagcttcaagatgctgtggacggtgctgaaaacttaattgaagaagtcaattatgaagttttgagactaaaggtggaaggtcagtgtcaaaatcttggagaaacaagcaatcaacaggtaagtgactgcaacctgtgcttgagtgatgatttttttcttaacataaaggagaagttggaagagaccattgaaacattggaagagttggaaaagcaaattggtcgccttgatctaacaaagtatcttgattcgggtaaacaagaaacaagggaatcttcaacttctgttgttgatgaatctgatatcttaggtaggcagaacgaaatagagggattgattgaccgtttgttgtctgaggatggaaagaatctgactgtagttcctgttgttggaatggggggcgtgggcaagacaacacttgctaaagctgtttacaatgatgagaaagtaaaaaaccattttggtttcaaagcttggatctgtgtgtctgaaccatatgatattctcagaataacaaaggagttacttcaagaatttggcttaatggttgataacaatctgaatcaacttcaagtcaaattgaaggagagcttaaagggaaaaaagtttcttattgtcctagatgatgtatggaatgaaaactataaagagtgggatgacttgagaaatctttttgtacaaggagatgtaggaagtaagatcattgtgacgacacgtaaggagagtgttgccttgatgatgggttgtggggcaatcaacgtggggactctatctagtgaagtctcttgggatcttttcaagcggcattcatttgaaaatagggatcctaaggaacatccagaacttgaagagattggaatacaaattgcatacaagtgcaaaggtttgcctttagctctaaaggcacttgctggtattttacgctccaaatcagaggtggatgagtggagacacattttaagaagtgaaatatgggagctgcaaagtcgttcgaatggaatcttaccagcgttgatgttgagctataatgatcttcctccacaattgaagcggtgttttgctttttgtgcaatatatccgaaagattatctattttgcaaagaacaagttgttcacctgtggattgctaatggtcttgtacagcagttgcattcagctaaccaatactttctcgagttgagatcgcgatcattgtttgaaaaggtccgagagtcttctaaatggaattcgggggaattcttaatgcatgaccttgtcaacgatttggcccaaattgcatcttcaaatctgtgtatgaggttggaagagaaccaaggatctcatatgttggaacgaactcgacatttgtcgtattcaatgggtgatggtgatttcggtaaactgaaaaccctcaacaaattggagcaattgaggacattgcttcccatcaatatccagcggcgtccatgccatcttaagaagaggatgcttcatgacatatttccaagactaatatccctaagggcactatcactgtctccttatgatattgaggagttgccgaatgacttgtttatcaaattgaagcacctaaaatttttggacctttcttggacacagataaaaaagttgccagattcaatttgtgaactgtacagcttagagatacttatcttgtcacattgtagtcatcttaatgagccaccgctgcagatggagaagttgatcaacttgcatcacctcgacgttagcgacgcttatttcttgaagacgccgctacatgtgagcaagttgaaaaatctccatgtgctagtgggagctaaattttttcttactggttccagtggtttgagaattgaagatttgggtgaactacataacttgtatggatctctatcaattctagagttgcaacatgtggtagatagaagggaatctctgaaggcaaatatgagggaaaagaaacatgttgaaaggttatctttggagtgggggggaagttttgctgacaattcacaaactgaaagagacatacttgatgagctacaaccaaatacaaacataaaagaactccgaatcactggctatagaggaacaaaatttccaaattggctagctgatcattcatttcataagctaatagaaatgtctcttagctactgcaaggactgtgattccttgccagcactaggacagcttccttgtttaaaatcccttaccattagagggatgcatcaaataacagaggtgagtgaagagttctatggtcgtttttcctccacaaagccatttaactctcttgagaaacttgaatttgcagagatgccggagtggaagcagtggcatgtactggggaagggagagttccctgtactagaggaacttttgatttatcgttgcccaaagttgattgggaagttgcctgaaaatgtttcttcgctgagaagattgagaattttaaaatgccctgaactcagtttggagacacctatccaactttcaaatttaaaagagtttgaagttgctgatgctcaactgtttacatctcaacttgaaggaatgaagcagattgttaaattagatattactgattgtaagtctcttacctccttacctattagcattctgccgagtaccttgaagagaataagaatagctttttgtggggagctgaaattggaggcgtcgatgaatgctatgtttctcgagaaattgtctctagtaaaatgtgattctcctgagttggtcccaagagcacgcaatttgagtgtaagaagttgcaacaaccttactaggcttttgattcctactgccactgaaagactcagtattagagattatgataatcttgaaatactttcagtggcacgtgggactcagatgacatcattgaatatttacgactgcaagaagctgaagtcgctgccagaacatatgcaggaactccttccatctcttaagaaactggttgtgcaagcttgtccagaaatagagtcctttcctgaaggaggattgcccttcaatttacaagccctttcaatctggaattgcaagaaactggtgaatggccgaaaagagtggcatttacagagactcccctctctcatagatttaaccatctaccatgatggtagcgatgaagaggttcttgctggtgaaaaatgggagttgccttgctctattcgaaggcttactatatccaatctgaaaacattaagcagccaacttctcaaaagcctcacctcccttgagtacctagatgctagagagttgcctcaaattcagtcactgctggaagaagggcttcctttctctctttctgagctaatattatttagtaatcatgatcttcattcactaccgacagaaggtcttcagcatctcacgtggcttcgacgtctagagattgtgggttgccctagtctccaatctcttcccgaatcggggttgccctcctccctctctgagctgggcatttggaattgctctaatcttcaatctcttcccgaatcagggatgcccccttccatctctaaactacgcatttccgaatgcccattgctcaaaccactcctagaatttaacaagggggattactggccaaaaattgctcatattcccaccatatatattgataaggaatactag MEIGLAVGGAFLSSALNVLFDRLAPNSDLLKMFKRDKRDVRLLKKLRMTLLGLQAVLSDAENKQASNPYVSQWLNELQDAVDGAENLIEEVNYEVLRLKVEGQCQNLGETSNQQVSDCNLCLSDDFFLNIKEKLEETIETLEELEKQIGRLDLTKYLDSGKQETRESSTSVVDESDILGRQNEIEGLIDRLLSEDGKNLTVVPVVGMGGVGKTTLAKAVYNDEKVKNHFGFKAWICVSEPYDILRITKELLQEFGLMVDNNLNQLQVKLKESLKGKKFLIVLDDVWNENYKEWDDLRNLFVQGDVGSKIIVTTRKESVALMMGCGAINVGTLSSEVSWDLFKRHSFENRDPKEHPELEEIGIQIAYKCKGLPLALKALAGILRSKSEVDEWRHILRSEIWELQSRSNGILPALMLSYNDLPPQLKRCFAFCAIYPKDYLFCKEQVVHLWIANGLVQQLHSANQYFLELRSRSLFEKVRESSKWNSGEFLMHDLVNDLAQIASSNLCMRLEENQGSHMLERTRHLSYSMGDGDFGKLKTLNKLEQLRTLLPINIQRRPCHLKKRMLHDIFPRLISLRALSLSPYDIEELPNDLFIKLKHLKFLDLSWTQIKKLPDSICELYSLEILILSHCSHLNEPPLQMEKLINLHHLDVSDAYFLKTPLHVSKLKNLHVLVGAKFFLTGSSGLRIEDLGELHNLYGSLSILELQHVVDRRESLKANMREKKHVERLSLEWGGSFADNSQTERDILDELQPNTNIKELRITGYRGTKFPNWLADHSFHKLIEMSLSYCKDCDSLPALGQLPCLKSLTIRGMHQITEVSEEFYGRFSSTKPFNSLEKLEFAEMPEWKQWHVLGKGEFPVLEELLIYRCPKLIGKLPENVSSLRRLRILKCPELSLETPIQLSNLKEFEVADAQLFTSQLEGMKQIVKLDITDCKSLTSLPISILPSTLKRIRIAFCGELKLEASMNAMFLEKLSLVKCDSPELVPRARNLSVRSCNNLTRLLIPTATERLSIRDYDNLEILSVARGTQMTSLNIYDCKKLKSLPEHMQELLPSLKKLVVQACPEIESFPEGGLPFNLQALSIWNCKKLVNGRKEWHLQRLPSLIDLTIYHDGSDEEVLAGEKWELPCSIRRLTISNLKTLSSQLLKSLTSLEYLDARELPQIQSLLEEGLPFSLSELILFSNHDLHSLPTEGLQHLTWLRRLEIVGCPSLQSLPESGLPSSLSELGIWNCSNLQSLPESGMPPSISKLRISECPLLKPLLEFNKGDYWPKIAHIPTIYIDKEY PMID: 21649512 Rpi-vnt1.1 NF4FS Solanum venturii 710 3385 agttatacaccctacattctactcgagtcattatgatgatgtctcacgaccaaatcaaatcaaagttaaataaatatcgaaccgaacgcccactctgtatgagtatggcaaaagattttgagagaatcaagttgcataaaagcctaattttcatggaacatacaaattgagtctcataatagcccaaactcacagccatgaacccaaattgggtaaagttttgcaagacgttcatcaaacagttaggaaacataaaatggcgctagatatataataaatttttttaacatatggtgtgattgatagttatatactaaagatgtttgcttagttacgtaattttttcaaaaaaaaaaggtacattatcaatcatcagtcacaaaatattaaaagttactgtttgttttttaaattccatgtcgaatttaattgaatgacacttaaattgggacgaacggtgtaatttcttttgactattctactagtatctatccacagcacgtgttgttcctttcttctttcgtttttcatttacttgacattattaggagacttggccctgaactccaactattctaagctgacctttcttttcctttaccaattatcttcttctttctaatttcgttttacgcgtagtactgcctgaattttctgactttcaacgtttgttattcatgcttgaaaacgaaataccagctaacaaaagatgaattattgtgtttacaagacttgggccgttgactcttactttcccttcctcatcctcacatttagaaaaaagaaatttaacgaaaaattaaaggagatggctgaaattcttctcacagcagtcatcaataaatcaatagaaatagctggaaatgtactctttcaagaaggtacgcgtttatattggttgaaagaggacatcgattggctccagagagaaatgagacacattcgatcatatgtagacaatgcaaaggcaaaggaagttggaggcgattcaagggtgaaaaacttattaaaagatattcaacaactggcaggtgatgtggaggatctattagatgagtttcttccaaaaattcaacaatccaataagttcatttgttgccttaagacggtttcttttgccgatgagtttgctatggagattgagaagataaaaagaagagttgctgatattgaccgtgtaaggacaacttacagcatcacagatacaagtaacaataatgatgattgcattccattggaccggagaagattgttccttcatgctgatgaaacagaggtcatcggtctggaagatgacttcaatacactacaagccaaattacttgatcatgatttgccttatggagttgtttcaatagttggcatgcccggtttgggaaaaacaactcttgccaagaaactttataggcatgtctgtcatcaatttgagtgttcgggactggtctatgtttcacaacagccaagggcgggagaaatcttacatgacatagccaaacaagttggactgacggaagaggaaaggaaagaaaacttggagaacaacctacgatcactcttgaaaataaaaaggtatgttattctcttagatgacatttgggatgttgaaatttgggatgatctaaaacttgtccttcctgaatgtgattcaaaaattggcagtaggataattataacctctcgaaatagtaatgtaggcagatacataggaggggatttctcaatccacgtgttgcaacccctagattcagagaaaagctttgaactctttaccaagaaaatctttaattttgttaatgataattgggccaatgcttcaccagacttggtaaatattggtagatgtatagttgagagatgtggaggtataccgctagcaattgtggtgactgcaggcatgttaagggcaagaggaagaacagaacatgcatggaacagagtacttgagagtatggctcataaaattcaagatggatgtggtaaggtattggctctgagttacaatgatttgcccattgcattaaggccatgtttcttgtactttggtctttaccccgaggaccatgaaattcgtgcttttgatttgacaaatatgtggattgctgagaagctgatagttgtaaatactggcaatgggcgagaggctgaaagtttggcggatgatgtcctaaatgatttggtttcaagaaacttgattcaagttgccaaaaggacatatgatggaagaatttcaagttgtcgcatacatgacttgttacatagtttgtgtgtggacttggctaaggaaagtaacttctttcacacggagcacaatgcatttggtgatcctagcaatgttgctagggtgcgaaggattacattctactctgatgataatgccatgaatgagttcttccatttaaatcctaagcctatgaagcttcgttcacttttctgtttcacaaaagaccgttgcatattttctcaaatggctcatcttaacttcaaattattgcaagtgttggttgtagtcatgtctcaaaagggttatcagcatgttactttccccaaaaaaattgggaacatgagttgcctacgttatgtgcgattggagggggcaattagagtaaaattgccaaatagtattgtcaagctcaaatgtctagagaccctggatatatttcatagctctagtaaacttccttttggtgtttgggagtctaaaatattgagacatctttgttacacagaagaatgttactgtgtctcttttgcaagtccattttgccgaatcatgcctcctaataatctacaaactttgatgtgggtggatgataaattttgtgaaccaagattgttgcaccgattgataaatttaagaacattgtgtataatggatgtatccggttctaccattaagatattatcagcattgagccctgtgcctagagcgttggaggttctgaagctcagatttttcaagaacacgagtgagcaaataaacttgtcgtcccatccaaatattgtcgagttgggtttggttggtttctcagcaatgctcttgaacattgaagcattccctccaaatcttgtcaagcttaatcttgtcggcttgatggtagacggtcatctattggcagtgcttaagaaattgcccaaattaaggatacttatattgctttggtgcagacatgatgcagaaaaaatggatctctctggtgatagctttccgcaacttgaagttttgtatattgaggatgcacaagggttgtctgaagtaacgtgcatggatgatatgagtatgcctaaattgaaaaagctatttcttgtacaaggcccaaacatttccccaattagtctcagggtctcggaacggcttgcaaagttgagaatatcacaggtactataaataattatttacgtttaatatccatgatttttttaaatttgtatttagttcatcaactaaatattccatgtctaataaattgcagggatgcctttgaaaatgattctgtgttggagagaatcttctgatgcctgttggtattataatactaataataagagaaaaagtttgattactgtttcaagttaattgcttgtgatttgtaaaaacaaattacttttatatttctctttgttttattttatgtttatttatctttaattaatggagtaataaaataaaaatcttattttcaatagaaaaaagtagaccttatttgtggtgcatgtatggtatctttttgaaatttttgatatatttgctctttgattcgaatttcttgcttatatgatgatttgcataaatataaaatattatacaaatacctatgggttggaaaatatagaaatatgccaatcaaatgtatacaaaaatcattaatagatagaatcgtaaaagatatacaaatgagaaatgcttgactaagaagcttcgtgcaacctctcacactgagcacaatgcatttggtgatctcggcactattgctgttacttgtaagactacgttccccaataagtctttccaaacggcttgcaaagctgagaatatgaaaatctcataggttagtttgctgcgttaattatttacatttaatatgctcgataaggtgattttaaaaaaatttgtactagttaattcatgaactaaatatttcatttaatactccataattctgaatatggaaaataaataatatttaataacaagaataaaatgataaattattcattgattttataaattggataaatattattaaatattcttaaataatataatgaacaagtgaagatgaacggagggagtatgaagcctcttttcaaag MNYCVYKTWAVDSYFPFLILTFRKKKFNEKLKEMAEILLTAVINKSIEIAGNVLFQEGTRLYWLKEDIDWLQREMRHIRSYVDNAKAKEVGGDSRVKNLLKDIQQLAGDVEDLLDEFLPKIQQSNKFICCLKTVSFADEFAMEIEKIKRRVADIDRVRTTYSITDTSNNNDDCIPLDRRRLFLHADETEVIGLEDDFNTLQAKLLDHDLPYGVVSIVGMPGLGKTTLAKKLYRHVCHQFECSGLVYVSQQPRAGEILHDIAKQVGLTEEERKENLENNLRSLLKIKRYVILLDDIWDVEIWDDLKLVLPECDSKIGSRIIITSRNSNVGRYIGGDFSIHVLQPLDSEKSFELFTKKIFNFVNDNWANASPDLVNIGRCIVERCGGIPLAIVVTAGMLRARGRTEHAWNRVLESMAHKIQDGCGKVLALSYNDLPIALRPCFLYFGLYPEDHEIRAFDLTNMWIAEKLIVVNTGNGREAESLADDVLNDLVSRNLIQVAKRTYDGRISSCRIHDLLHSLCVDLAKESNFFHTEHNAFGDPSNVARVRRITFYSDDNAMNEFFHLNPKPMKLRSLFCFTKDRCIFSQMAHLNFKLLQVLVVVMSQKGYQHVTFPKKIGNMSCLRYVRLEGAIRVKLPNSIVKLKCLETLDIFHSSSKLPFGVWESKILRHLCYTEECYCVSFASPFCRIMPPNNLQTLMWVDDKFCEPRLLHRLINLRTLCIMDVSGSTIKILSALSPVPRALEVLKLRFFKNTSEQINLSSHPNIVELGLVGFSAMLLNIEAFPPNLVKLNLVGLMVDGHLLAVLKKLPKLRILILLWCRHDAEKMDLSGDSFPQLEVLYIEDAQGLSEVTCMDDMSMPKLKKLFLVQGPNISPISLRVSERLAKLRISQVL "PMID: 19348576, 19348577" Rpi-sto1 Solanum stoloniferum 1 3592 atggctgaagctttcattcaagttctgttagacaatctcacttctttcctcaaaggggaacttacattgcttttcggttttcaagatgagttccaaaggctttcaagcatgttttctacaatccaagccgtccttgaagatgctcaggagaagcaactcaacaacaagcctctagaaaattggttgcaaaaactcaatgctgctacatacgaagtcgatgacatcttggatgaatataaaaccaaggccacaagattctcccagtctgaatatggccgttatcatccaaaggttatccctttccgtcacaaggtcgggaaaaggatggaccaagtgatgaaaaaactaaaggcaattgctgaggaaagaaagaattttcatttgcacgaaaaaattgtagagagacaagctgttagacgggaaacaggtactcatcttaaattagtattacaacaactaagtttatattcatttttttggcaattatcaaattcagaaaagggttaaatatactcatgtcctatcgtaaatagtgtaaatatacctctcgttgtactttcgatctgaatatacttgtcaaatctggcaagctcagaatcaaattatccaccccaacttttaaatactcgacatctttagaaatccacctgtctaactcatccactacccattccctttgctttgaattcttttctttacctataaacttggaacactcgatccgttttgcttttcttaacaaagcagctcagagaaaagaggttttcttctattctgtttctctgtgtgctgcacttgggtccttaatcccattaaaaacagggcatgttaatcccaacgacggtagcctttcctgacagctgactgtaaattttgtctaacaaagaaaaaaaaagattagacatgtttttccttgtcattgattaggctggatttctttcagagtggaacataggggatatattggaccaaaaatagaatgggtatatatttaaagtatttctgatagaacaggagtatattgtgcgaaaatatcctctattttctgttgtctcctaatgagtttgaatgtaataatattctcatgtggacattgcttgcaccaggttctgtattaaccgaaccgcaggtttatggaagagacaaagagaaagatgagatagtgaaaatcctaataaacaatgttagtgatgcccaacacctttcagtcctcccaatacttggtatggggggattaggaaaaacgactcttgcccaaatggtcttcaatgaccagagagttactgagcatttccattccaaaatatggatttgtgtctcggaagattttgatgagaagaggttaataaaggcaattgtagaatctattgaaggaaggccactacttggtgagatggacttggctccacttcaaaagaagcttcaggagttgctgaatggaaaaagatacttgcttgtcttagatgatgtttggaatgaagatcaacagaagtgggcaaatttaagagcagtcttgaaggttggagcaagtggtgcttctgttctaaccactactcgtcttgaaaaggttggatcaattatgggaacattgcaaccatatgaactgtcaaatctgtctcaagaagattgttggttgttgttcatgcaacgtgcatttggacaccaagaagaaataaatccaaaccttgtggcaatcggaaaggagattgtgaaaaaaagtggtggtgtgcctctagcagccaaaactcttggaggtattttgtgcttcaagagagaagaaagagcatgggaacatgtgagagacagtccgatttggaatttgcctcaagatgaaagttctattctgcctgccctgaggcttagttaccatcaacttccacttgatttgaaacaatgctttgcgtattgtgcggtgttcccaaaggatgccaaaatggaaaaagaaaagctaatctctctctggatggcgcatggttttcttttatcaaaaggaaacatggagctagaggatgtgggtgatgaagtatggaaagaattatacttgaggtcttttttccaagagattgaagttaaagatggtaaaacttatttcaagatgcatgatctcatccatgatttggcaacatctctgttttcagcaaacacatcaagcagcaatatccgtgaaataaataaacacagttacacacatatgatgtccattggtttcgccgaagtggtgtttttttacactcttccccccttggaaaagtttatctcgttaagagtgcttaatctaggtgattcgacatttaataagttaccatcttccattggagatctagtacatttaagatacttgaacctgtatggcagtggcatgcgtagtcttccaaagcagttatgcaagcttcaaaatctgcaaactcttgatctacaatattgcaccaagctttgttgtttgccaaaagaaacaagtaaacttggtagtctccgaaatcttttacttgatggtagccagtcattgacttgtatgccaccaaggataggatcattgacatgccttaagactctaggtcaatttgttgttggaaggaagaaaggttatcaacttggtgaactaggaaacctaaatctctatggctcaattaaaatctcgcatcttgagagagtgaagaatgataaggacgcaaaagaagccaatttatctgcaaaagggaatctgcattctttaagcatgagttggaataactttggaccacatatatatgaatcagaagaagttaaagtgcttgaagccctcaaaccacactccaatctgacttctttaaaaatctatggcttcagaggaatccatctcccagagtggatgaatcactcagtattgaaaaatattgtctctattctaattagcaacttcagaaactgctcatgcttaccaccctttggtgatctgccttgtctagaaagtctagagttacactgggggtctgcggatgtggagtatgttgaagaagtggatattgatgttcattctggattccccacaagaataaggtttccatccttgaggaaacttgatatatgggactttggtagtctgaaaggattgctgaaaaaggaaggagaagagcaattccctgtgcttgaagagatgataattcacgagtgcccttttctgaccctttcttctaatcttagggctcttacttccctcagaatttgctataataaagtagctacttcattcccagaagagatgttcaaaaaccttgcaaatctcaaatacttgacaatctctcggtgcaataatctcaaagagctgcctaccagcttggctagtctgaatgctttgaaaagtctaaaaattcaattgtgttgcgcactagagagtctccctgaggaagggctggaaggtttatcttcactcacagagttatttgttgaacactgtaacatgctaaaatgtttaccagagggattgcagcacctaacaaccctcacaagtttaaaaattcggggatgtccacaactgatcaagcggtgtgagaagggaataggagaagactggcacaaaatttctcacattcctaatgtgaatatatataattaa MAEAFIQVLLDNLTSFLKGELTLLFGFQDEFQRLSSMFSTIQAVLEDAQEKQLNNKPLENWLQKLNAATYEVDDILDEYKTKATRFSQSEYGRYHPKVIPFRHKVGKRMDQVMKKLKAIAEERKNFHLHEKIVERQAVRRETGSVLTEPQVYGRDKEKDEIVKILINNVSDAQHLSVLPILGMGGLGKTTLAQMVFNDQRVTEHFHSKIWICVSEDFDEKRLIKAIVESIEGRPLLGEMDLAPLQKKLQELLNGKRYLLVLDDVWNEDQQKWANLRAVLKVGASGASVLTTTRLEKVGSIMGTLQPYELSNLSQEDCWLLFMQRAFGHQEEINPNLVAIGKEIVKKSGGVPLAAKTLGGILCFKREERAWEHVRDSPIWNLPQDESSILPALRLSYHQLPLDLKQCFAYCAVFPKDAKMEKEKLISLWMAHGFLLSKGNMELEDVGDEVWKELYLRSFFQEIEVKDGKTYFKMHDLIHDLATSLFSANTSSSNIREINKHSYTHMMSIGFAEVVFFYTLPPLEKFISLRVLNLGDSTFNKLPSSIGDLVHLRYLNLYGSGMRSLPKQLCKLQNLQTLDLQYCTKLCCLPKETSKLGSLRNLLLDGSQSLTCMPPRIGSLTCLKTLGQFVVGRKKGYQLGELGNLNLYGSIKISHLERVKNDKDAKEANLSAKGNLHSLSMSWNNFGPHIYESEEVKVLEALKPHSNLTSLKIYGFRGIHLPEWMNHSVLKNIVSILISNFRNCSCLPPFGDLPCLESLELHWGSADVEYVEEVDIDVHSGFPTRIRFPSLRKLDIWDFGSLKGLLKKEGEEQFPVLEEMIIHECPFLTLSSNLRALTSLRICYNKVATSFPEEMFKNLANLKYLTISRCNNLKELPTSLASLNALKSLKIQLCCALESLPEEGLEGLSSLTELFVEHCNMLKCLPEGLQHLTTLTSLKIRGCPQLIKRCEKGIGEDWHKISHIPNVNIYN PMID: 18682852 Rpi-pta1 Solanum papita 1 3592 atggctgaagctttcattcaagttctgttagacaatctcacttctttcctcaaaggggaacttacattgcttttcggttttcaagatgagttccaaaggctttcaagcatgttttctacaatccaagccgtccttgaagatgctcaggagaagcaactcaacaacaagcctctagaaaattggttgcaaaaactcaatgctgctacatacgaagtcgatgacatcttggatgaatataaaaccaaggccacaagattctcccagtctgaatatggccgttatcatccaaaggttatccctttccgtcacaaggtcgggaaaaggatggaccaagtgatgaaaaaactaaaggcaattgctgaggaaagaaagaattttcatttgcacgaaaaaattgtagagagacaagctgttagacgggaaacaggtactcatcttaaattagtattacaacaactaagtttatattcatttttttggcaattatcaaattcagaaaagggttaaatatactcatgtcctatcgtaaatagtgtaaatatacctctcgttgtactttcgatctgaatatacttgtcaaatctggcaagctcagaatcaaattatccaccccaacttttaaatactcgacatctttagaaatccacctgtctaactcatccactacccattccctttgctttgaattcttttctttacctataaacttggaacactcgatccgttttgcttttcttaacaaagcagctcagagaaaagaggttttcttctattctgtttctctgtgtgctgcacttgggtccttaatcccattaaaaacagggcatgttaatcccaacgacggtagcctttcctgacagctgactgtaaattttgtctaacaaagaaaaaaaaagattagacatgtttttccttgtcattgattaggctggatttctttcagagtggaacataggggatatattggaccaaaaatagaatgggtatatatttaaagtatttctgatagaacaggagtatattgtgcgaaaatatcctctattttctgttgtctcctaatgagtttgaatgtaataatattctcatgtggacattgcttgcaccaggttctgtattaaccgaaccgcaggtttatggaagagacaaagagaaagatgagatagtgaaaatcctaataaacaatgttagtgatgcccaacacctttcagtcctcccaatacttggtatggggggattaggaaaaacgactcttgcccaaatggtcttcaatgaccagagagttactgagcatttccattccaaaatatggatttgtgtctcggaagattttgatgagaagaggttaataaaggcaattgtagaatctattgaaggaaggccactacttggtgagatggacttggctccacttcaaaagaagcttcaggagttgctgaatggaaaaagatacttgcttgtcttagatgatgtttggaatgaagatcaacagaagtgggctaatttaagagcagtcttgaaggttggagcaagtggtgcttctgttctaaccactactcgtcttgaaaaggttggatcaattatgggaacattgcaaccatatgaactgtcaaatctgtctcaagaagattgttggttgttgttcatgcaacgtgcatttggacaccaagaagaaataaatccaaaccttgtggcaatcggaaaggagattgtgaaaaaaagtggtggtgtgcctctagcagccaaaactcttggaggtattttgtgcttcaagagagaagaaagagcatgggaacatgtgagagacagtccgatttggaatttgcctcaagatgaaagttctattctgcctgccctgaggcttagttaccatcaacttccacttgatttgaaacaatgctttgcgtattgtgcggtgttcccaaaggatgccaaaatggaaaaagaaaagctaatctctctctggatggcgcatggttttcttttatcaaaaggaaacatggagctagaggatgtgggcgatgaagtatggaaagaattatacttgaggtcttttttccaagagattgaagttaaagatggtaaaacttatttcaagatgcatgatctcatccatgatttggcaacatctctgttttcagcaaacacatcaagcagcaatatccgtgaaataaataaacacagttacacacatatgatgtccattggtttcgccgaagtggtgtttttttacactcttccccccttggaaaagtttatctcgttaagagtgcttaatctaggtgattcgacatttaataagttaccatcttccattggagatctagtacatttaagatacttgaacctgtatggcagtggcatgcgtagtcttccaaagcagttatgcaagcttcaaaatctgcaaactcttgatctacaatattgcaccaagctttgttgtttgccaaaagaaacaagtaaacttggtagtctccgaaatcttttacttgatggtagccagtcattgacttgtatgccaccaaggataggatcattgacatgccttaagactctaggtcaatttgttgttggaaggaagaaaggttatcaacttggtgaactaggaaacctaaatctctatggctcaattaaaatctcgcatcttgagagagtgaagaatgatagggacgcaaaagaagccaatttatctgcaaaagggaatctgcattctttaagcatgagttggaataactttggaccacatatatatgaatcagaagaagttaaagtgcttgaagccctcaaaccacactccaatctgacttctttaaaaatctatggcttcagaggaatccatctcccagagtggatgaatcactcagtattgaaaaatattgtctctattctaattagcaacttcagaaactgctcatgcttaccaccctttggtgatctgccttgtctagaaagtctagagttacactgggggtctgcggatgtggagtatgttgaagaagtggatattgatgttcattctggattccccacaagaataaggtttccatccttgaggaaacttgatatatgggactttggtagtctgaaaggattgctgaaaaaggaaggagaagagcaattccctgtgcttgaagagctgataattcacgagtgcccttttctgaccctttcttctaatcttagggctcttacttccctcagaatttgctataataaagtagctacttcattcccagaagagatgttcaaaaaccttgcaaatctcaaatacttgacaatctctcggtgcaataatctcaaagagctgcctaccagcttggctagtctgaatgctttgaaaagtctaaaaattcaattgtgttgcgcactagagagtctccctgaggaagggctggaaggtttatcttcactcacagagttatttgttgaacactgtaacatgctaaaatgtttaccagagggattgcagcacctaacaaccctcacaagtttaaaaattcggggatgtccacaactgatcaagcggtgtgagaagggaataggagaagactggcacaaaatttctcacattcctaatgtgaatatatataattaa MAEAFIQVLLDNLTSFLKGELTLLFGFQDEFQRLSSMFSTIQAVLEDAQEKQLNNKPLENWLQKLNAATYEVDDILDEYKTKATRFSQSEYGRYHPKVIPFRHKVGKRMDQVMKKLKAIAEERKNFHLHEKIVERQAVRRETGSVLTEPQVYGRDKEKDEIVKILINNVSDAQHLSVLPILGMGGLGKTTLAQMVFNDQRVTEHFHSKIWICVSEDFDEKRLIKAIVESIEGRPLLGEMDLAPLQKKLQELLNGKRYLLVLDDVWNEDQQKWANLRAVLKVGASGASVLTTTRLEKVGSIMGTLQPYELSNLSQEDCWLLFMQRAFGHQEEINPNLVAIGKEIVKKSGGVPLAAKTLGGILCFKREERAWEHVRDSPIWNLPQDESSILPALRLSYHQLPLDLKQCFAYCAVFPKDAKMEKEKLISLWMAHGFLLSKGNMELEDVGDEVWKELYLRSFFQEIEVKDGKTYFKMHDLIHDLATSLFSANTSSSNIREINKHSYTHMMSIGFAEVVFFYTLPPLEKFISLRVLNLGDSTFNKLPSSIGDLVHLRYLNLYGSGMRSLPKQLCKLQNLQTLDLQYCTKLCCLPKETSKLGSLRNLLLDGSQSLTCMPPRIGSLTCLKTLGQFVVGRKKGYQLGELGNLNLYGSIKISHLERVKNDRDAKEANLSAKGNLHSLSMSWNNFGPHIYESEEVKVLEALKPHSNLTSLKIYGFRGIHLPEWMNHSVLKNIVSILISNFRNCSCLPPFGDLPCLESLELHWGSADVEYVEEVDIDVHSGFPTRIRFPSLRKLDIWDFGSLKGLLKKEGEEQFPVLEELIIHECPFLTLSSNLRALTSLRICYNKVATSFPEEMFKNLANLKYLTISRCNNLKELPTSLASLNALKSLKIQLCCALESLPEEGLEGLSSLTELFVEHCNMLKCLPEGLQHLTTLTSLKIRGCPQLIKRCEKGIGEDWHKISHIPNVNIYN PMID: 18682852 R2 Solanum demissum 1 2538 atggctgatgcctttctatcatttgcagttcaaaaattgggtgatttcctcattcaacaagtttctctgcgtaaaaatctgagaaaggaaattgagtggctgagaaatgagctactcttcatacagtctttcctcagagatgcagaactaaagcaatatggagatcaaagagttcaacaatgggtgtttgagatcaactctattgctaatgatgttgttgctatactcgagacttacaccttcgaggctggtaaaggtgctagtcgtctcaaggcttgcgcttgcatatatacgaaggagaagaaattctacaatgttgccgaggagatccaatcactcaagcaacgaatcatggatatctctcgcaaacgagagacttatggtattacaaatatcaataataattcaggagaagggccaagtaatcaggttagaacattgaggagaactacctcatatgtggatgaccaggattacatttttgttggacttcaggatgttgtacaaaaattgctagctcaacttctcaaagcagagccccgtcgaaccgtcctctccattcatggcatgggcggattgggcaagaccactcttgcgagaaaactttacaacagttctgctatactcaatagcttccctacacgcgcttggatatgtgtctctcaagagtacaacacaatggatcttcttaggaatatcataaaatccgtccaaggtcgcaccaaggaaactctagatttgttggaaaggatgacagaaggagatctagaaatctatcttcgtgatctattaaaagaacgcaaataccttgtgatggttgatgatgtatggcagaaagaagcatgggatagtttgaagagagcattcccggatagcaagaatggcagcagagtcattattaccacgcgcaaacaggatgtcgctgaaagagcagacgacataggttttgttcataaacttcgtttcctaagtcaagaagaaagttgggatctctttcgtaagaaactacttgatgttcgatcaatggttccagaaatggaaaatctagctaaggatatggtggaaaagtgtagaggcttacctcttgcaattgttgtattgagcggactactttcgcataaaaaggggctaaaccaatggcaaaaggtgaaagatcacctttggaagaacattaaagaagataaatctattgaaatctctaacatactatccttaagctacaatgatttgtcaactgcgctcaagcagtgttttctctactttggtatttttccagaagatcaagtggtaaaggctgatgacataatacggttgtggatggcggagggtttcatacccagaggagaagaaagaatggaggatgtggctgacggcttcttgaatgaactgataagacgaagcttggttcaagtagctaaaacattttgggaaaaagttactgactgtagggttcatgatttacttcgtgatcttgcgatacaaaaggtattggaggtaaacttctttgacatttatgatccaagaagccactccatatcctctttatgtatcagacatggcattcatagtgaaggagaaaggtacctctcatcacttgatctttctaacttgaagttgaggtcaattatgttcttcgatccatatatttgtaatgtgttccaacatatagatgtgtttcgacatctatatgtgttgtacttggatacgaattttgggtatgtgtctatggtacctgatgccataggaagtttgtaccacctcaagttgttaagattgagaggtatccatgatattccgtcttccattggcaacctcaagaatttacaaacacttgtcgttgtaaatggttacacatttttttgcgaactaccctgcaagacagctgacctaataaatctaagacatttagttgttcaatatacagagcctttaaaatgtataaacaaactcactagtcttcaagttcttgatggtgttgcttgtgatcagtggaaagatgttgaccctgttgatttagtcaatcttcgagaattaagcatggatcgtatcaggagctcttactccctaaacaacattagcagcttgaaaaaccttagcactctcaaattgatttgtggagaacgtcaatcatttgcatcccttgaatttgttaattgttgtgaaaagctccagaaattgtggttacaagggagaatagaggaactgcctcatctgttttcaaactccatcacaatgatggttctgagtttctcagaactgacagaagatccgatgcctattttgggaaggtttccaaacctaaggaatctcaaattagatggagcttacgaaggaaaagaaataatgtgcagtgataacagcttcagtcaactagagttccttcatcttcgtgatctttggaagctagaaagatgggatttaggcacaagtgccatgcctctgattaaaggtcttggtatccataactgtccaaatttaaaggagattcctgagagaatgaaagacgtggagctgttgaagcggaattatatgttgtga MADAFLSFAVQKLGDFLIQQVSLRKNLRKEIEWLRNELLFIQSFLRDAELKQYGDQRVQQWVFEINSIANDVVAILETYTFEAGKGASRLKACACIYTKEKKFYNVAEEIQSLKQRIMDISRKRETYGITNINNNSGEGPSNQVRTLRRTTSYVDDQDYIFVGLQDVVQKLLAQLLKAEPRRTVLSIHGMGGLGKTTLARKLYNSSAILNSFPTRAWICVSQEYNTMDLLRNIIKSVQGRTKETLDLLERMTEGDLEIYLRDLLKERKYLVMVDDVWQKEAWDSLKRAFPDSKNGSRVIITTRKQDVAERADDIGFVHKLRFLSQEESWDLFRKKLLDVRSMVPEMENLAKDMVEKCRGLPLAIVVLSGLLSHKKGLNQWQKVKDHLWKNIKEDKSIEISNILSLSYNDLSTALKQCFLYFGIFPEDQVVKADDIIRLWMAEGFIPRGEERMEDVADGFLNELIRRSLVQVAKTFWEKVTDCRVHDLLRDLAIQKVLEVNFFDIYDPRSHSISSLCIRHGIHSEGERYLSSLDLSNLKLRSIMFFDPYICNVFQHIDVFRHLYVLYLDTNFGYVSMVPDAIGSLYHLKLLRLRGIHDIPSSIGNLKNLQTLVVVNGYTFFCELPCKTADLINLRHLVVQYTEPLKCINKLTSLQVLDGVACDQWKDVDPVDLVNLRELSMDRIRSSYSLNNISSLKNLSTLKLICGERQSFASLEFVNCCEKLQKLWLQGRIEELPHLFSNSITMMVLSFSELTEDPMPILGRFPNLRNLKLDGAYEGKEIMCSDNSFSQLEFLHLRDLWKLERWDLGTSAMPLIKGLGIHNCPNLKEIPERMKDVELLKRNYML PMID: 19445588 Rpi-blb3 Solanum bulbocastanum 2939 5482 aaaacggattcggggagtgaaaagcttaccgttagcctcaagaacgatggaaaactatcaagagtcgtctggggttcgttccttagctctaaaaatcgaaaagtgcagaataaagacgttttgaggcttatttacgcactacaaaaaaatcatatattgctgcaaaatttgttgtagctaaatatgaaaatttccatggctaaacttcaatattttcttccttagcattcgtagcaagatatagcatggctaaaagttagctacaaactttacatggttcatggctgagaactaatatctattgctacaaaatttttgagttgtagctgtactgataaaaagtttttgccacacaaaatatatatatatatatagcaaataactttattcttttgccacgtcaaaaatgatttatagttgtctttttagatgcagccacaaagctattacattgtagcaacatatttaatttggtttccatgtaaacagaaatttgtagctatttgtatagcttagtcacgtggcaatagtactcgtatttagttatgactattaaaattcatggcaataacatgaagtatttaccacaagcattttcgaattatagctaaaattcatatctttagccatgaatatatataattttagctaaaaatccatttgctacgaaagtcaaaatttatatacatgtttttttacgtgatatatatagaaaatttgttgcattcaatatataattccattattattagagattttttcgcaagctttattagttccaagagctacataatgtagctatgaattaatttttaagatttcaaaacacttcctaaattacgtataattacaatttacaattttaaaaatagttctaattatatataactcatgtaatacactatcttgtttgagtacaaagcagtatagtcttctcttatttctccttccacaacgttcaattgaatcttagcttgatttacaccgatcttgtcatttagatgctttaactccattgatatacctatcaaaatgatgaagtatttcaacaccaacaatcattaccaactaattatagatgagagtgtgtgttatataatatttcaagaagacaacaaatttatttatatatatatcattagctaaaaaatttgaaagatacaaacaaaaatatgcaagaaaaaaaagtaaacaaatctataaacttttatttcttaaaataatgttcacctcaattgtgacatttttggcggtttgcgaattatgactcctctcaacactatttaaattttaaaatcttcacaatctgctcataaataagatgtaatattttttaaaagatctaaaataatctaaacccaaaaatctaagtcaaataagtgaaacataaattcgaaaattgtaaataagaagatatgaacatgccttgaatataaaaaaaccacaaaaagaaattagcaaaacattctacattttgaaatgccaaagtcttctctctcaacatttatctcttgagcaagaagatttccatgtaaacttcatgtcctttactttaagcattacttccgatattgttcttacctttgtcaaggaacctagtccattgacctatggtggacacagataagctaacaacatttaataccctaactaccattaccacaacaggtagagtacgctgaatttttctaagttgtgtcaccatttaaaggacaaaaatgactcaagagtaaaatcaatgaagcatttgctgcaggcctccaaaagttttatcgatatatttttttttaataatttgctcgttcttccaaatcagttgaaacttgagttgttaaaattgatttggtacgtctggattttttttcaaataataccgctccatcaaatttagattaatatgatgtaatatgcacaattagaattgcggacaattgtaaccaatttaatgaattcaaaattatttcattgtaacaagcaaatagtaaaaaataaaattattattatgaacaaataaaaagggacaaggcataagtactctcctagactatgactgaaatctcagaaacacacataaacttaactagggtcctattaccccctaaactaatttaaaatggaataaatacaccacaaacggtgacatgacatagagagtgtacacactctattgaaggcaattgattagtgcacaaattggacacatgtcatttttttattgataactttattattagttagtacacatatttattgataataaaaattatatatatataattatttttatttctttctttgtaaaatatttattttaatttctttttactttaaacttttttttatttaatttattatgttttcacttttgattatttaaaaaaaatttatgtgtattttttaaaaaagtaattttaaagtgtcctttaattttaatgttttaacttttttatgttttatttgaatttcttcacttattttaatatccgttcaatttaatgaatcctaaattatttcattgtaacaagtaaatagaaaaaaataaaataagtcttatgaagaaataaaaacaaatatattttttccacaagttgtgtaatgattgttgaagatgcttccattttttaaatcttttctcaatatatattttccacaagttgtgcaatgattgctgaagttgctttattgttttaagacttttctctatatgtgtttttccccaagttgtataatggttgttgaagatgctttaattaaaaaaaaaaaccttttgtttagtggaaaatttcaaaaagctttagtacatctttgtcgttttatccaatcgtaattctttattcagaaaccacatgttttttttctaatcttacttttatgtctatcacccattttccaatatacagcctactctttttttcaatcaaaactagtattcctaaagatggctgatgcctttctatcatttgcagttcaaaaattgggtgatttcctaatacagaaagtttccctgcgtaaaagtctcagagatgaaattagatggctgataaatgagctactcttcatacggtctttcctcagagatgcagaacaaaagcagtgcggagatcaaagagttcaacaatgggtgtttgagatcaactctattgctaatgatgctgttgctatactcgagacttatagctttgaggctggtaaaggtgctagtcgtctcaaggcttgcacttgcatatgtaggaaggagaagaaattctacaatgttgccgaggagattcaatcactcaagcaacgaatcatggatatctctcgcaaacgagagacttatggtattacaaatatcaattataattcaggagaaaggccaagtaatcaggttacaacattgaggagaactacctcatatgtagatgaacaggattacatttttgttggctttcaggatgttgtacaaacattgctagctcaacttctgaaagcagagcctcgtcgaagcgtcctctccatttatggaatggggggtttaggcaagaccactcttgccagaaaactttacaccagtcctgatatactcaatagctttcctacacgcgcttggatatgtgtctctcaagagtacaacacaatggatcttcttaggactatcataaaatccatccaaggctgcgccaaggaaactctagatttgttggaaaagatggcagaaatagatctagaaaatcaccttcgtgatctattgaaagaatgcaaataccttgtggtggttgatgatgtatggcagagagaagcatgggagagtttgaaaagagcattcccggatggcaagaatggaagcagagtcattattaccacgcgcaaagaggatgtcgctgaaagagtagaccacagaggttttgttcataaacttcgtttcctaagtcaagaagaaagttgggatctctttcgtaggaaactacttgatgttcgagcaatggttccagaaatggaaagtttagctaaggatatggtggaaaagtgtagaggcttacctcttgcaattgttgtattgagcggactactttcgcataaaaaggggctaaaccaatggcaaaaggtgaaagatcacctttggaagaacattaaagaagataaatctattgaaatctctaacatactatccttaagctacaatgatttgtcaactgcgctcaagcagtgttttctctactttggtatttttccagaagatcaagtggtaaaggctgatgacataatacggttgtggatggcggagggtttcatacccagaggagaagaaagaatggaggatgtggctgacggcttcttgaatgaactgataagacgaagcttggttcaagtagctaaaacattttgggaaaaagttactgactgtagggttcatgatttacttcgtgatcttgcgatacaaaaggcattggaggtaaacttctttgacgtttatggtccaagaagccactccatatcctctttatgtatcagacatggcattcatagtgaaggagaaaggtacctctcatcacttgatctttctaacttgaagttgaggtcaattatgttcttcgatccagattttcgtaagatgagtcatataaacctcaggagtgagttccaacatctgtatgtgttgtacttggatacgaattttgggtatgtgtctatggtacctgatgccataggaagtttgtaccacctcaagttgttaagattgagaggtatccatgatattccgtcttccattggcaacctcaagaatttacaaacacttgtcgttgtaaatggttacacatttttttgccaactaccctgcaagacagctgacctaataaatctaagacatttagttgttcaatattcagagcctttaaaatgtataaacaaactcactagtcttcaagttcttgatggtgttgcttgtgatcagtggaaagatgttgaccctgttgatttagtcaatcttcgagaattaagcatggatcgtatcaggagctcttactccctaaacaacattagcagcttgaaaaaccttagcactctcaaattgatttgtggagaacgtcaatcatttgcatcccttgaatttgttaattgttgtgaaaagctccagaaattgtggttacaagggagaatagaggaactgcctcatctgttttcaaactccatcacaatgatggttctgagtttctcagaactgacagaagatccgatgcctattttgggaaggtttccaaacctaaggaatctcaaattagatggagcttatgaaggaaaagaaataatgtgcagtgataacagcttcagtcaactagagttccttcatcttcgtgatctttggaagctagaaagatgggatttaggcacaagtgccatgcctctgattaaaggtcttggtatccataactgtccaaatttaaaggagattcctgagagaatgaaagacatggagctgttgaagcggaattatatgttgtgaagcttttctgccaagcacattggttattaattgagtggttttagtgttgatttcttattattgttttaagctttttgagtgtgtaattggtttgaacattattgttttaattaattggtctactgtatgttctcatgcttatccacatttaagacaatgctttatatgttaaaatgaaattaaaaatactagtatatggtactctctcttgtccacaatttcgtatattttttgttcctcttcataaaaaaaatggtaaaaaataccattaaactatgtgataggaacaaaaatgtcttctattataatttaacttaaaaatgtctttactgtcagtaccttagttcaaaattgccctcgagtccgtagttacaaaatgtcctttttcgaataaatatatatatttttttaaacacatcttcttcctaattaaaatattattaaagaagactattcttgttttcttttttctaaaaatcactttaacaaataaaaatgtaggaaatattttgttttcttcttaatctcactttatcaattaaaatagaataactccatgtaccctttcgacatataatatatgtcatatatatatataagatcatagtatatgcatcattaatttatatttatataacgataaaaaataatgataataaaataagaaatatttttattttttattttcttctgaattgaagtaatataaacatttgctaattttaaaaaaaaataatacaaaaataatgtgttaaaaagaaaataataatatatttatttggaaaatgagtatttttgatccattaaataacagtaagtgtatttttagaccaaagtattgacaacaagggtatttttggatcaaacgacaaacggagggtacttttgctcctttcgcataatttaagggtatttttaaaccaaaatattgacggtaaaggcatttttgagtcaaattatgaacgaaagacatttttatttctttcacatagtttaaggacatttttgacccatttccctcctttatataaataatatttatgttaaatcaacagagaagaagctgtcaattgaagacattcactttcatcaacttggcttctccaagcatcaatcaacttggattatttcaacattctgttttttcaatgtttaatttctttctatttttggaaacatgtgttggaagagaaccttttttctggattttgtgatgacctaattaacgaaacaaagttaaaaatgttcttaaattatgtaaaatgaataaaaatatcctcagttaatagtttgatccaaaaatattgttgtctctaataattgatctaaaaatgatattattgttacttaataagtgaaaaccgtctttttttcaattaaatatattatttttctttttttaaaacacgctcttttcctaataatgattttttttcattaaaaaatattcatcctacttcaatttataaaaaatattactaataaataaaaatgttttttatattattagaaagttttttatcgttatttaaatgaaaattaatgacggggttactatgaggacatataatggaagaagttgagaactcgcttagtgtgaagcgagaataactaaaaaaaaaaaaaaaacttacaaactcgcttggtgcggagcgatttttgggggaaaatagagagcaaatcgctcataggtagcgagaaaaaaaagataaaataaaagagaaaatcgctcgtaagtcaacaagatgatcaatttttttatgccgttaacgatagttatagcacaaacatatctcgctccttctctagcaaagtgtcccttttgattaaaccaaaaattgaaagaccctttatgtattttaaagaaaaaaagtgatgtttttaactttgaattcgaaatttaatcatcccaatataattcataaacgaatttttacatcaattttaaaataaagaataaaaaaaagaaagataatatatactagcagggaactacatgtgattactacaaaagataaattcaatttcaggtggtatttggatttgaattgtcttaccttgctatcataacattatttttgtttttatccattaaaaaaatgatgcatttatatatttattactagtaaagtaatatctttaatgtgtcaacacataagtatccctcaattagtaaaatgttaggacttttttcatgtgagaaacccaacctcattgaaaaaggaaattaatacattttaactcaacttttaattaattaatgtcaagtttgataaaaataaataaaaaaacaatcgtagacaatctctaattattagaattttacaatatgcatatttaatgggttatataaattttgagttggccttctttttttcttcttgtgattctaagtcctccactttatttttatttttatatttataattaaatattttttactcgattcacagaccgagttggaccagtccaatcttgattaagcctcacgagttgacgagcttatttaggcttggctaaataatttcgttcttaaatgaacttttaattttttttgagctcaatcctatcaaatcgcagattaggttggatttgggtgaaacaatggaccaaagtccaaactaacagctccaaaatctacgaggtttagaaatagaaagtcttcttatatgttatgtatatctaacaaattatatgttatgtatgatattgtataaatagttatttaatgtatcaatattgtataataacatatagttatgtatttataatgtataactatatatgatattgtataaatagttatttaatgtatcgatattgtatagtagcatatagttatgtatttataatgtatgtataactatgtatgatattgtataaatagattttggacttgggaagtctgcagcaagcaaaggaagaggtccaggtagcaacacttttatcttaatgaatacaccaaatgatgatc MADAFLSFAVQKLGDFLIQKVSLRKSLRDEIRWLINELLFIRSFLRDAEQKQCGDQRVQQWVFEINSIANDAVAILETYSFEAGKGASRLKACTCICRKEKKFYNVAEEIQSLKQRIMDISRKRETYGITNINYNSGERPSNQVTTLRRTTSYVDEQDYIFVGFQDVVQTLLAQLLKAEPRRSVLSIYGMGGLGKTTLARKLYTSPDILNSFPTRAWICVSQEYNTMDLLRTIIKSIQGCAKETLDLLEKMAEIDLENHLRDLLKECKYLVVVDDVWQREAWESLKRAFPDGKNGSRVIITTRKEDVAERVDHRGFVHKLRFLSQEESWDLFRRKLLDVRAMVPEMESLAKDMVEKCRGLPLAIVVLSGLLSHKKGLNQWQKVKDHLWKNIKEDKSIEISNILSLSYNDLSTALKQCFLYFGIFPEDQVVKADDIIRLWMAEGFIPRGEERMEDVADGFLNELIRRSLVQVAKTFWEKVTDCRVHDLLRDLAIQKALEVNFFDVYGPRSHSISSLCIRHGIHSEGERYLSSLDLSNLKLRSIMFFDPDFRKMSHINLRSEFQHLYVLYLDTNFGYVSMVPDAIGSLYHLKLLRLRGIHDIPSSIGNLKNLQTLVVVNGYTFFCQLPCKTADLINLRHLVVQYSEPLKCINKLTSLQVLDGVACDQWKDVDPVDLVNLRELSMDRIRSSYSLNNISSLKNLSTLKLICGERQSFASLEFVNCCEKLQKLWLQGRIEELPHLFSNSITMMVLSFSELTEDPMPILGRFPNLRNLKLDGAYEGKEIMCSDNSFSQLEFLHLRDLWKLERWDLGTSAMPLIKGLGIHNCPNLKEIPERMKDMELLKRNYML PMID: 19445588 Rpi-abpt1 Solanum sp 1 2538 atggctgatgcctttctatcatttgcagttcaaaaattgggtgatttcctaatacagaaagtttccctgcgtaaaagtctcagagacgaaattagatggctgatcaatgagctactcttcatacggtctttcctcagagatgcagaacaaaagcagtgcggagatcaaagagttcaacaatgggtgtttgagatcaactctattgctaatgatgctgttgctatactcgagacttatagctttgaggctggtaaaggtgctagtcgtctcaaggcttgcacttgcatatgtaggaaggagaagaaattctacaatgttgccgaggagattcaatcactcaagcaacgaatcatggatatctctcgcaaacgagagacttatggtattacaaatatcaataataatgcaggagaagggccaagtaatcaggttacaaaattgaggagaactacctcatatgtagatgaacaggattacatttttgttggctttcaggatgttgtacaaacatttctagctcaacttctgaaagcagagcctcgtcgaagcgtcctctccatttatggaatggggggtttaggcaagaccactcttgccagaaaactttacaccagtcctgatatactcaatagcttccgtacacgcgcttggatatgtgtctctcaagagtacaacacaatggatcttcttaggaatatcataaaatccatccaaggtcgcaccaaggaaactctagatttgttggaaaggatgacagaaggagatcttgaaatttatcttcgtgatttattgaaagaacgcaaataccttgtggtggttgatgatgtatggcagagagaagcatgggagagtttgaaaagatcattcccggatggcaagaatggcagcagagtcattattaccacgcgcaaagaggatgtcgctgaaagagcagacgacagaggttttgttcataaacttcgtttcctaagccaagaagaaagttgggatctctttcgtaggaaactacttgatgttcgagcaatggttccagaaatggaaagtctagctaaggatatggtggaaaagtgtagaggcttacctcttgcaattgttgtattgagcggactactttcgcataaaaaggggctaaaccaatggcaaaaggtgaaagatcacctttggaagaacattaaagaagataaatctattgaaatctctaacatactatccttaagctacaatgatttgtcaactgcgctcaagcagtgttttctctactttggtatttttccagaagatcaagtggtaaaggctgatgacataatacggttgtggatggcggagggtttcatacccagaggagaagaaagaatggaggatgtggctgacggcttcttgaatgaactgataagacgaagcttggttcaagtagctaaaacattttgggaaaaagttactgactgtagggttcatgatttacttcgtgatcttgcgatacaaaaggcattggaggtaaacttctttgacatttatgatccaagaagccactccatatcctctttatgtatcagacatggcattcatagtgaaggagaaaggtacctctcatcacttgatctttctaacttgaagttgaggtcaattatgttcttcgatccatatatttgtaatgtgttccaacatatagatgtgtttcgacatctatatgtgttgtacttggatacgaattttgggtatgtgtctatggtacctgatgccataggaagtttgtaccacctcaagttgttaagattgagaggtatccatgatattccgtcttccattggcaacctcaagaatttacaaacacttgtcgttgtaaatggttacacatttttttgcgaactaccctgcaagacagctgacctaataaatctaagacatttagttgttcaatatacagagcctttaaaatgtataaacaaactcactagtcttcaagttcttgatggtgttgcttgtgatcagtggaaagatgttgaccctgttgatttagtcaatcttcgagaattaagcatggatcgtatcaggagctcttactccctaaacaacattagcagcttgaaaaaccttagcactctcaaattgatttgtggagaacgtcaatcatttgcatcccttgaatttgttaattgttgtgaaaagctccagaaattgtggttacaagggagaatagaggaactgcctcatctgttttcaaactccatcacaatgatggttctgagtttctcagaactgacagaagatccgatgcctattttgggaaggtttccaaacctaaggaatctcaaattagatggagcttacgaaggaaaagaaataatgtgcagtgataacagcttcagtcaactagagttccttcatcttcgtgatctttggaagctagaaagatgggatttaggcacaagtgccatgcctctgattaaaggtcttggtatccataactgtccaaatttaaaggagattcctgagagaatgaaagacgtggagctgttgaagcggaattatatgttgtga MADAFLSFAVQKLGDFLIQKVSLRKSLRDEIRWLINELLFIRSFLRDAEQKQCGDQRVQQWVFEINSIANDAVAILETYSFEAGKGASRLKACTCICRKEKKFYNVAEEIQSLKQRIMDISRKRETYGITNINNNAGEGPSNQVTKLRRTTSYVDEQDYIFVGFQDVVQTFLAQLLKAEPRRSVLSIYGMGGLGKTTLARKLYTSPDILNSFRTRAWICVSQEYNTMDLLRNIIKSIQGRTKETLDLLERMTEGDLEIYLRDLLKERKYLVVVDDVWQREAWESLKRSFPDGKNGSRVIITTRKEDVAERADDRGFVHKLRFLSQEESWDLFRRKLLDVRAMVPEMESLAKDMVEKCRGLPLAIVVLSGLLSHKKGLNQWQKVKDHLWKNIKEDKSIEISNILSLSYNDLSTALKQCFLYFGIFPEDQVVKADDIIRLWMAEGFIPRGEERMEDVADGFLNELIRRSLVQVAKTFWEKVTDCRVHDLLRDLAIQKALEVNFFDIYDPRSHSISSLCIRHGIHSEGERYLSSLDLSNLKLRSIMFFDPYICNVFQHIDVFRHLYVLYLDTNFGYVSMVPDAIGSLYHLKLLRLRGIHDIPSSIGNLKNLQTLVVVNGYTFFCELPCKTADLINLRHLVVQYTEPLKCINKLTSLQVLDGVACDQWKDVDPVDLVNLRELSMDRIRSSYSLNNISSLKNLSTLKLICGERQSFASLEFVNCCEKLQKLWLQGRIEELPHLFSNSITMMVLSFSELTEDPMPILGRFPNLRNLKLDGAYEGKEIMCSDNSFSQLEFLHLRDLWKLERWDLGTSAMPLIKGLGIHNCPNLKEIPERMKDVELLKRNYML PMID: 19445588

Pages in category "Reference R-Genes, manually curated"

The following 112 pages are in this category, out of 112 total.

P

P cont.

P cont.

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox