PRGDB00000499 (Hm2)

From PRG Wiki
Revision as of 22:31, 4 August 2012 by Cepabot (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
Hm2
Gene Type Reference_R-Genes,_manually_curated
GenBank 165875427 (EU367521)
Gene Class Other
Domain Type
Gene Species Zea mays

Comment?

Zea mays NADPH HC toxin reductase-like protein (Hm2) mRNA, complete cds.

DNA Sequence

ATGGGTGGCGGCACGGTGGTGTGTGTCACCGGCGGCAGCGGCTACCTCGGGAGCTGGCTCGTCAGGAAGCTCCTCGGCAGAGGCTGCGTCGTCCACGCCACCCTGCGGAGCCTCGCGGACGAGAAGAAGACGGGGCTGCTCCGGGCGCTCCCCGGCGCGGCGGAGCGGCTGCGGCTGTTCGAGGCGGACATGTACGACGCCGACACCTTCGAGCCCGCCATCGCCGGCTGCCACTTCGTCTTCCTCGTCGCCACGCCCCTGACGCACGACCCCACCAGCACCAAGTACAAGAACACGACGGAGGCGGCGGTGGACGCGGCGCGCATCATCCTCCGGCAGTGCGCGCTGTCCGGCACGGTGAAGCGCGTCATCCACACGGCCTCGGTCACGGCCGCGTCGCCGCTCAAGGAGGACGGCAGCGGGTACAAGGACTTCGCCGACGAGTCCAATTGGACGCCGCTCAACCTCTCCTGCGAATTCAGCAACGCTTACCTGGACGACTACGTGCGGTCCAAGACGCTGTCGGAGAAGGAGCTACTGAGCTACTCCTCCTCCTCCTCCTCCAAGGAAGACGACCGGACCCGGGCGTTGGAGGTGGTCACCCTAACGTGCGGGCTCGTCGGCGGCGACAGCATCCAGACGTACCTGTGGGGCAACATCGCCGCGATTCTGGCGCCGCTGACGGGGCAAGCGGTCAATCACAACGCCCTCCTCTTCTTGCAAGCGCTGCTGGGCTCCGTGCCGCTGGTGCACGTTGAGGACGTCTGCCAGGCACACGTCTTCTGCATGGAGCAGGAGTCCATGACCGGCCGCTTCCTCTGCGCCGCCGGGTACCCCAACATGCGTGACATCGTCGACCACTTTGCCGCAAAGCAACCCCGACCTCAAGATACAGCTGACTCAAGTGACCGGAGAAGGGGTCAGGATTCAGCCCAACACCAGCAAGCTGGAGGACTTGGGGTTCAGATTCAAGTATGGAGTGGAGGAGACGCTGGACTGCAGCGTCGAGTGCGCCAAGAGGCTGGGAGAGCTCTAGATGCATGCTACGCATGCATGCGCAGCATTGGGATTCAGCGACTGTGA


Protein sequences

Name Description Sequence
NADPH HC toxin reductase-like protein NADPH HC toxin reductase-like protein [Zea mays].

MGGGTVVCVTGGSGYLGSWLVRKLLGRGCVVHATLRSLADEKKTGLLRALPGAAERLRLFEADMYDADTFEPAIAGCHFVFLVATPLTHDPTSTKYKNTTEAAVDAARIILRQCALSGTVKRVIHTASVTAASPLKEDGSGYKDFADESNWTPLNLSCEFSNAYLDDYVRSKTLSEKELLSYSSSSSSKEDDRTRALEVVTLTCGLVGGDSIQTYLWGNIAAILAPLTGQAVNHNALLFLQALLGSVPLVHVEDVCQAHVFCMEQESMTGRFLCAAGYPNMRDIVDHFAAKQPRPQDTADSSDRRRGQDSAQHQQAGGLGVQIQVWSGGDAGLQRRVRQEAGRALDACYACMRSIGIQRL

Domains

Domain Start-End Description Sequence

superfamily: SSF51735
4-302 NAD(P)-bd

GTVVCVTGGSGYLGSWLVRKLLGRGCVVHATLRSLADEKKTGLLRALPGAAERLRLFEADMYDADTFEPAIAGCHFVFLVATPLTHDPTSTKYKNTTEAAVDAARIILRQCALSGTVKRVIHTASVTAASPLKEDGSGYKDFADESNWTPLNLSCEFSNAYLDDYVRSKTLSEKELLSYSSSSSSKEDDRTRALEVVTLTCGLVGGDSIQTYLWGNIAAILAPLTGQAVNHNALLFLQALLGSVPLVHVEDVCQAHVFCMEQESMTGRFLCAAGYPNMRDIVDHFAAKQPRPQDTADSS

Gene3D: G3DSA:3.40.50.720
IPR016040
5-293 NAD(P)-bd
NAD(P)-binding domain

TVVCVTGGSGYLGSWLVRKLLGRGCVVHATLRSLADEKKTGLLRALPGAAERLRLFEADMYDADTFEPAIAGCHFVFLVATPLTHDPTSTKYKNTTEAAVDAARIILRQCALSGTVKRVIHTASVTAASPLKEDGSGYKDFADESNWTPLNLSCEFSNAYLDDYVRSKTLSEKELLSYSSSSSSKEDDRTRALEVVTLTCGLVGGDSIQTYLWGNIAAILAPLTGQAVNHNALLFLQALLGSVPLVHVEDVCQAHVFCMEQESMTGRFLCAAGYPNMRDIVDHFAAKQP

HMMPanther: PTHR10366
7-293 PTHR10366,NAD DEPENDENT EPIMERASE/DEHYDRATASE

VCVTGGSGYLGSWLVRKLLGRGCVVHATLRSLADEKKTGLLRALPGAAERLRLFEADMYDADTFEPAIAGCHFVFLVATPLTHDPTSTKYKNTTEAAVDAARIILRQCALSGTVKRVIHTASVTAASPLKEDGSGYKDFADESNWTPLNLSCEFSNAYLDDYVRSKTLSEKELLSYSSSSSSKEDDRTRALEVVTLTCGLVGGDSIQTYLWGNIAAILAPLTGQAVNHNALLFLQALLGSVPLVHVEDVCQAHVFCMEQESMTGRFLCAAGYPNMRDIVDHFAAKQP

HMMPanther: PTHR10366:SF81
7-293 PTHR10366:SF81,OS07G0601100 PROTEIN

VCVTGGSGYLGSWLVRKLLGRGCVVHATLRSLADEKKTGLLRALPGAAERLRLFEADMYDADTFEPAIAGCHFVFLVATPLTHDPTSTKYKNTTEAAVDAARIILRQCALSGTVKRVIHTASVTAASPLKEDGSGYKDFADESNWTPLNLSCEFSNAYLDDYVRSKTLSEKELLSYSSSSSSKEDDRTRALEVVTLTCGLVGGDSIQTYLWGNIAAILAPLTGQAVNHNALLFLQALLGSVPLVHVEDVCQAHVFCMEQESMTGRFLCAAGYPNMRDIVDHFAAKQP

HMMPfam: PF01370
IPR001509
7-270 Epimerase
NAD-dependent epimerase/dehydratase

VCVTGGSGYLGSWLVRKLLGRGCVVHATLRSLADEKKTGLLRALPGAAERLRLFEADMYDADTFEPAIAGCHFVFLVATPLTHDPTSTKYKNTTEAAVDAARIILRQCALSGTVKRVIHTASVTAASPLKEDGSGYKDFADESNWTPLNLSCEFSNAYLDDYVRSKTLSEKELLSYSSSSSSKEDDRTRALEVVTLTCGLVGGDSIQTYLWGNIAAILAPLTGQAVNHNALLFLQALLGSVPLVHVEDVCQAHVFCMEQESMTG


Diseases

Disease Pathogen Avirulence gene
Leaf Spot

List of References



List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox