PRGDB00035723 (Mlo)

From PRG Wiki
Jump to: navigation, search
Mlo
Gene Type Reference_R-Genes,_manually_curated
GenBank 1877220 (Z83834)
Gene Class Other
Domain Type MLO
Gene Species Hordeum vulgare

Comment?

H.vulgare mRNA for Mlo protein.

DNA Sequence

ATGTCGGACAAAAAAGGGGTGCCGGCGCGGGAGCTGCCGGAGACGCCGTCGTGGGCGGTGGCGGTGGTCTTCGCCGCCATGGTGCTCGTGTCCGTCCTCATGGAACACGGCCTCCACAAGCTCGGCCATTGGTTCCAGCACCGGCACAAGAAGGCCCTGTGGGAGGCGCTGGAGAAGATGAAGGCGGAGCTCATGCTGGTGGGCTTCATATCCCTGCTCCTCATCGTCACGCAGGACCCCATCATCGCCAAGATATGCATCTCCGAGGATGCCGCCGACGTCATGTGGCCCTGCAAGCGCGGCACCGAGGGCCGCAAGCCCAGCAAGTACGTTGACTACTGCCCGGAGGGCAAGGTGGCGCTCATGTCCACGGGCAGCTTGCACCAGCTGCACGTCTTCATCTTCGTGCTCGCGGTCTTCCATGTCACCTACAGCGTCATCACCATAGCTCTAAGCCGTCTCAAAATGAGAACATGGAAGAAATGGGAGACAGAGACCACCTCCTTGGAATACCAGTTCGCAAATGATCCTGCACGGTTCCGGTTCACGCACCAGACGTCGTTCGTGAAGCGCCACCTGGGCCTCTCCAGCACCCCTGGCATCAGATGGGTGGTGGCCTTCTTCAGGCAGTTCTTCAGGTCAGTCACCAAGGTGGACTACCTGACCTTGAGGGCAGGCTTCATCAACGCGCATTTGTCGCAAAACAGCAAGTTCGACTTCCACAAGTACATCAAGAGGTCGATGGAGGACGACTTCAAGGTCGTCGTCGGCATCAGCCTCCCGCTGTGGGGTGTGGCGATCCTCACCCTCTTCCTTGACATCAATGGGGTTGGCACGCTCATCTGGATTTCTTTCATCCCTCTCGTGATCCTCTTGTGTGTTGGAACCAAGCTGGAGATGATCATCATGGAGATGGCCCTGGAGATCCAGGACCGGGCGAGCGTCATCAAGGGGGCCCCCGTGGTCGAGCCCAGCAACAAGTTCTTCTGGTTCCACCGCCCCGACTGGGTCCTCTTCTTCATACACCTGACGTTGTTCCAGAACGCGTTTCAGATGGCGCATTTTGTGTGGACAGTGGCCACGCCCGGCTTGAAGAAATGCTACCACACGCAGATCGGGCTGAGCATCATGAAGGTGGTGGTGGGGCTAGCTCTCCAGTTCCTCTGCAGCTATATGACCTTCCCCCTCTACGCGCTCGTCACACAGATGGGATCAAACATGAAGAGGTCCATCTTCGACGAGCAGACGTCCAAGGCGCTCACCAACTGGCGGAACACGGCCAAGGAGAAGAAGAAAGTCCGAGACACGGACATGCTGATGGCTCAGATGATCGGCGACGCAACACCGAGCCGAGGCTCGTCGCCGATGCCGAGCCGGGGCTCATCACCCGTGCACCTGCTTCACAAGGGCATGGGGCGGTCGGACGACCCCCAGAGCGCGCCCACCTCGCCAAGGACCCAGCAGGAGGCTAGGGACATGTACCCGGTTGTGGTGGCGCACCCGGTGCACAGACTAAATCCTAACGACAGGAGGAGGTCCGCCTCGTCGTCGGCCCTCGAAGCCGACATCCCCAGTGCAGATTTTTCCTTCAGCCAGGGATGA


Protein sequences

Name Description Sequence
Mlo Mlo [Hordeum vulgare subsp. vulgare].

MSDKKGVPARELPETPSWAVAVVFAAMVLVSVLMEHGLHKLGHWFQHRHKKALWEALEKMKAELMLVGFISLLLIVTQDPIIAKICISEDAADVMWPCKRGTEGRKPSKYVDYCPEGKVALMSTGSLHQLHVFIFVLAVFHVTYSVITIALSRLKMRTWKKWETETTSLEYQFANDPARFRFTHQTSFVKRHLGLSSTPGIRWVVAFFRQFFRSVTKVDYLTLRAGFINAHLSQNSKFDFHKYIKRSMEDDFKVVVGISLPLWGVAILTLFLDINGVGTLIWISFIPLVILLCVGTKLEMIIMEMALEIQDRASVIKGAPVVEPSNKFFWFHRPDWVLFFIHLTLFQNAFQMAHFVWTVATPGLKKCYHTQIGLSIMKVVVGLALQFLCSYMTFPLYALVTQMGSNMKRSIFDEQTSKALTNWRNTAKEKKKVRDTDMLMAQMIGDATPSRGSSPMPSRGSSPVHLLHKGMGRSDDPQSAPTSPRTQQEARDMYPVVVAHPVHRLNPNDRRRSASSSALEADIPSADFSFSQG

Domains

Domain Start-End Description Sequence

HMMPfam: PF03094
IPR004326
9-475 Mlo
Mlo-related protein

ARELPETPSWAVAVVFAAMVLVSVLMEHGLHKLGHWFQHRHKKALWEALEKMKAELMLVGFISLLLIVTQDPIIAKICISEDAADVMWPCKRGTEGRKPSKYVDYCPEGKVALMSTGSLHQLHVFIFVLAVFHVTYSVITIALSRLKMRTWKKWETETTSLEYQFANDPARFRFTHQTSFVKRHLGLSSTPGIRWVVAFFRQFFRSVTKVDYLTLRAGFINAHLSQNSKFDFHKYIKRSMEDDFKVVVGISLPLWGVAILTLFLDINGVGTLIWISFIPLVILLCVGTKLEMIIMEMALEIQDRASVIKGAPVVEPSNKFFWFHRPDWVLFFIHLTLFQNAFQMAHFVWTVATPGLKKCYHTQIGLSIMKVVVGLALQFLCSYMTFPLYALVTQMGSNMKRSIFDEQTSKALTNWRNTAKEKKKVRDTDMLMAQMIGDATPSRGSSPMPSRGSSPVHLLHKGMGRSD


Diseases

Disease Pathogen Avirulence gene
Powdery mildew (barley) Blumeria graminis

List of References



List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox