PRGDB00048126 (nbs)

From PRG Wiki
Revision as of 16:16, 7 August 2012 by Cepabot (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
nbs
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 166084560 (AM931317)
Gene Class NL
Domain Type NBS, LRR
Gene Species Musa balbisiana

Comment?

Musa balbisiana partial nbs gene for NBS-LRR disease resistance protein, cultivar Klutuk Wulung, clone N71_KW.

DNA Sequence

GGCATGGGGGGTGTGGGTAAGACTACTCTTGCTCAGCAAGCCTACAACCACGAGAGGGTGAAGGACTATTTTCATCCTAAGGTCTGGCTCTGTGTATCGGATAACTTCAACGTGGAGAGGCTTACCAAAGACATCGTAGAATCCATAACCGAGGAAAAGTGTGATCTCAGCAACCTTGATACACTTCAAGTGGTTGTTAAGAAGAAGCTGACCTCAAAAAGATTCCTGCTCGTCCTCGACGATGTGTGGAACGAGGACGGCCTGAAATGGGAAAGATTTTGTGCATCATTGAGGTACGGAGAACAAGGAAGCAAGATTTTGGTTACAACTCGCTCTAAAAAGATTGCAGAAATGGTTGGCAAACCGATCCCTCTAGGAGGTCTGGATGAAGCCAGCTATTGGGAATTTTTCAAACAATGTGCATTTGGTTCCGAAGACGCCGGTGAATTTCCACAGCTAGAAGCCATAGCAAAGAAGATCGCTGGCAGGTTGAAGGGGGCTGCCGTTGGCGGCAAAGACG


Protein sequences

Name Description Sequence
NBS-LRR disease resistance protein NBS-LRR disease resistance protein [Musa balbisiana].

GMGGVGKTTLAQQAYNHERVKDYFHPKVWLCVSDNFNVERLTKDIVESITEEKCDLSNLDTLQVVVKKKLTSKRFLLVLDDVWNEDGLKWERFCASLRYGEQGSKILVTTRSKKIAEMVGKPIPLGGLDEASYWEFFKQCAFGSEDAGEFPQLEAIAKKIAGRLKGAAVGGKD


Domains

Domain Start-End Description Sequence

HMMPanther: PTHR11017:SF28
1-166 PTHR11017:SF28

GMGGVGKTTLAQQAYNHERVKDYFHPKVWLCVSDNFNVERLTKDIVESITEEKCDLSNLDTLQVVVKKKLTSKRFLLVLDDVWNEDGLKWERFCASLRYGEQGSKILVTTRSKKIAEMVGKPIPLGGLDEASYWEFFKQCAFGSEDAGEFPQLEAIAKKIAGRLKG

HMMPfam: PF00931
IPR002182
1-166 NB-ARC,NBS
NB-ARC

GMGGVGKTTLAQQAYNHERVKDYFHPKVWLCVSDNFNVERLTKDIVESITEEKCDLSNLDTLQVVVKKKLTSKRFLLVLDDVWNEDGLKWERFCASLRYGEQGSKILVTTRSKKIAEMVGKPIPLGGLDEASYWEFFKQCAFGSEDAGEFPQLEAIAKKIAGRLKG

HMMPanther: PTHR11017
1-166 PTHR11017,LEUCINE-RICH REPEAT-CONTAINING PROTEIN

GMGGVGKTTLAQQAYNHERVKDYFHPKVWLCVSDNFNVERLTKDIVESITEEKCDLSNLDTLQVVVKKKLTSKRFLLVLDDVWNEDGLKWERFCASLRYGEQGSKILVTTRSKKIAEMVGKPIPLGGLDEASYWEFFKQCAFGSEDAGEFPQLEAIAKKIAGRLKG

Gene3D: G3DSA:3.40.50.300
1-100 G3DSA:3.40.50.300

GMGGVGKTTLAQQAYNHERVKDYFHPKVWLCVSDNFNVERLTKDIVESITEEKCDLSNLDTLQVVVKKKLTSKRFLLVLDDVWNEDGLKWERFCASLRYG

superfamily: SSF52540
1-161 SSF52540

GMGGVGKTTLAQQAYNHERVKDYFHPKVWLCVSDNFNVERLTKDIVESITEEKCDLSNLDTLQVVVKKKLTSKRFLLVLDDVWNEDGLKWERFCASLRYGEQGSKILVTTRSKKIAEMVGKPIPLGGLDEASYWEFFKQCAFGSEDAGEFPQLEAIAKKIA


List of References



List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox