PRGDB00065638 (Afp.4008)

From PRG Wiki
Revision as of 12:42, 5 September 2012 by Cepabot (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
Afp.4008
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 75452985 (DT763750)
Gene Class Unknown
Domain Type
Gene Species Aquilegia formosa x Aquilegia pubescens

Comment?

EST1197599 Aquilegia cDNA library Aquilegia formosa x Aquilegia pubescens cDNA clone CO1YY30, mRNA sequence

DNA Sequence

GCCTTCTTCACTCCTATATAGTGTGGCAACAAAGTGAGTTTAATTTATATAACAAAGGAGCTTATAGCATTTTACTGCATTAGCATGGATACTGGAAGAAGCAATAGTGCATCAACCTATTGTGTTACTGGTTCAACTGGGTACATAGGGTCATGGCTGGTTAAGTCTCTTCTTCAAAAGGGCTGCATAGTTCATGCTACTGCAAGAGACACAGGAAAATTTTCTTCTCTTCTGCCTTTGTGGAATGGTGGCGATCGGTTGAAATTGTTCAAAGCAGATTTGAGTCAAGAAGGAAGCTTTGATGAGGCTGTGAAGGGTTGTCATGGTGTATTTCATGTTGCAGCTTCAATGGAATTCAATGTCTTACCTACAGATAACATAGAAAATTATGTCCAATCACATATACTTGACCCTGCAATCAAGGGAACCTTAAACCTAATGAAAGCTTGCTCAAGAGAGAATGTGAAAAGGGTAGTATTCACCTCTTCCATAAGTACAATGACTGCTAAAGACATCAACGGGACATGGAAATCAATAGTGGATGAATCGTGCCGAACTGCGACAGATCAAGTGTGGAATATGAAGCCCAGCGGTTGGGTGTATGTACTTTCAAAGATTCTTTCAGAGGAAGCAGCTTTCAAGTTTGCAGATGAGAACGCAATTGATCTTATATCTATCATAACAACTACCGTTGCAGGCCCATTCCTTACTCCGACAGTTCCAGCAAGTGTTCAAATTCTCTTGTCACCCATCACAGGTGAGTTTGTATTCAACTCCATATTTACAGGTTGTGAATGACAGAATGGGATCAATCTCAGTAGTGCATATTGAAGACATATGCAATGCTCACATATTCCTTATGGAGCATACTACAGCAAAAAGTCCATATATTTGCTCTGCTCACAGTTTCTGTCATGTCT


Protein sequences

Name Description Sequence
Afp.4008 translated coding region predicted by ESTScan from UniGene Afp.4008

MDTGRSNSASTYCVTGSTGYIGSWLVKSLLQKGCIVHATARDTGKFSSLLPLWNGGDRLKLFKADLSQEGSFDEAVKGCHGVFHVAASMEFNVLPTDNIENYVQSHILDPAIKGTLNLMKACSRENVKRVVFTSSISTMTAKDINGTWKSIVDESCRTATDQVWNMKPSGWVYVLSKILSEEAAFKFADENAIDLISIITTTVAGPFLTPTVPASVQILLSPITGEFDSTPYLQVVNDRMGSISVVHIEDICNAHIFLMEHTTAKSPYICSAHSFCHVX

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR10366:SF9
1-278 CINNAMOYL-COA REDUCTASE,CINNAMOYL-COA REDUCTASE

MDTGRSNSASTYCVTGSTGYIGSWLVKSLLQKGCIVHATARDTGKFSSLLPLWNGGDRLKLFKADLSQEGSFDEAVKGCHGVFHVAASMEFNVLPTDNIENYVQSHILDPAIKGTLNLMKACSRENVKRVVFTSSISTMTAKDINGTWKSIVDESCRTATDQVWNMKPSGWVYVLSKILSEEAAFKFADENAIDLISIITTTVAGPFLTPTVPASVQILLSPITGEFDSTPYLQVVNDRMGSISVVHIEDICNAHIFLMEHTTAKSPYICSAHSFCHV

HMMPanther: PTHR10366
1-278 FAMILY NOT NAMED,NAD DEPENDENT EPIMERASE/DEHYDRATASE

MDTGRSNSASTYCVTGSTGYIGSWLVKSLLQKGCIVHATARDTGKFSSLLPLWNGGDRLKLFKADLSQEGSFDEAVKGCHGVFHVAASMEFNVLPTDNIENYVQSHILDPAIKGTLNLMKACSRENVKRVVFTSSISTMTAKDINGTWKSIVDESCRTATDQVWNMKPSGWVYVLSKILSEEAAFKFADENAIDLISIITTTVAGPFLTPTVPASVQILLSPITGEFDSTPYLQVVNDRMGSISVVHIEDICNAHIFLMEHTTAKSPYICSAHSFCHV

superfamily: SSF51735
10-273 NAD(P)-binding Rossmann-fold domains

STYCVTGSTGYIGSWLVKSLLQKGCIVHATARDTGKFSSLLPLWNGGDRLKLFKADLSQEGSFDEAVKGCHGVFHVAASMEFNVLPTDNIENYVQSHILDPAIKGTLNLMKACSRENVKRVVFTSSISTMTAKDINGTWKSIVDESCRTATDQVWNMKPSGWVYVLSKILSEEAAFKFADENAIDLISIITTTVAGPFLTPTVPASVQILLSPITGEFDSTPYLQVVNDRMGSISVVHIEDICNAHIFLMEHTTAKSPYICSAH

Gene3D: G3DSA:3.40.50.720
IPR016040
11-251 no description
NAD(P)-binding domain

TYCVTGSTGYIGSWLVKSLLQKGCIVHATARDTGKFSSLLPLWNGGDRLKLFKADLSQEGSFDEAVKGCHGVFHVAASMEFNVLPTDNIENYVQSHILDPAIKGTLNLMKACSRENVKRVVFTSSISTMTAKDINGTWKSIVDESCRTATDQVWNMKPSGWVYVLSKILSEEAAFKFADENAIDLISIITTTVAGPFLTPTVPASVQILLSPITGEFDSTPYLQVVNDRMGSISVVHIEDI

HMMPfam: PF01370
IPR001509
13-264 Epimerase
NAD-dependent epimerase/dehydratase

CVTGSTGYIGSWLVKSLLQKGCIVHATARDTGKFSSLLPLWNGGDRLKLFKADLSQEGSFDEAVKGCHGVFHVAASMEFNVLPTDNIENYVQSHILDPAIKGTLNLMKACSRENVKRVVFTSSISTMTAKDINGTWKSIVDESCRTATDQVWNMKPSGWVYVLSKILSEEAAFKFADENAIDLISIITTTVAGPFLTPTVPASVQILLSPITGEFDSTPYLQVVNDRMGSISVVHIEDICNAHIFLMEHTTA






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox