PRGDB00081109 (Pvr.39179)

From PRG Wiki
Revision as of 19:52, 5 September 2012 by Cepabot (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
Pvr.39179
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 198383572 (GD049013)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Saccharum hybrid cultivar

Comment?

CCHZ29135.g1 CCHZ Panicum virgatum abiotic and biotic stress treatments (N) Panicum virgatum cDNA clone CCHZ29135 3', mRNA sequence

DNA Sequence

AGCAATTTGCAAGCCACGATACATTGCATAGAAATATTGATAGATAGTCATACAGAGACATAGCAATTGTCTCTTAGAAGTTTGATCTTCTCAGCAGAATACATGTACTACGAATATACAAGATAAATTGTCCTTTTAGCTCTGCGAGGCTTAATAATGGACAGTAAAATGTACACCCTTATAGCTTGGCATGACATTTGACATCTGATTCATTCAAGTGATGAACCATGCTTGTGACTTTTCGATCCAATGTATGATGATTTGATAGCTTGCATTCTGCTAGCTATTTCTTTCATGTTCATTCGTTGACTTGGTAACGGGCGTGTAGACGAGAGCGCTACTTGGAGGAGGGCAGCTAAGCACTGGTACACTGCACTTTCATGTTGCTTATTTCCTTGAGGTAGGTCCTTGCATTCTTCTGAAAGATTAGCATCGATCACATGAAGCATTTGATGAGTATTGCTCTCCACAAAGCTGACAATGTCAAGCCCATCGTTGAACATAGGATCTGTTGGTCGTTTGCCTGTCATAATCTCAAGCAGAACTATTCCAAAACTATAAACATCCCCTGCAATTGATATCTGGCCTCCATGTGCATACTCTGGAGCAATATACCCTATGGTCCCTTTCACTCCTATTGAACTAGTTGAAGCAGTCGTTGTGGATGAAGCATCAACGTAAAACCTTGCAATGCCAAAGTCTCCCAAAAGAGCTGTCATATCATCGTCCAAAAGTATGTTGCTAGGCTTCAAGTCACAATGGACAGTGGCCTTCCCACAGTCGT


Protein sequences

Name Description Sequence
Pvr.39179 translated coding region predicted by ESTScan from UniGene Pvr.39179

XDCGKATVHCDLKPSNILLDDDMTALLGDFGIARFYVDASSTTTASTSSIGVKGTIGYIAPEYAHGGQISIAGDVYSFGIVLLEIMTGKRPTDPMFNDGLDIVSFVESNTHQMLHVIDANLSEECKDLPQGNKQHESAVYQCLAALLQVALSSTRPLPSQRMNMKEIASRMQAIKSSYIGSKSHKHGSSLE

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-179 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XDCGKATVHCDLKPSNILLDDDMTALLGDFGIARFYVDASSTTTASTSSIGVKGTIGYIAPEYAHGGQISIAGDVYSFGIVLLEIMTGKRPTDPMFNDGLDIVSFVESNTHQMLHVIDANLSEECKDLPQGNKQHESAVYQCLAALLQVALSSTRPLPSQRMNMKEIASRMQAIKSSYI

HMMSmart: SM00220
IPR002290
1-179 Serine/Threonine protein kinases, catalytic
Serine/threonine- / dual-specificity protein kinas

XDCGKATVHCDLKPSNILLDDDMTALLGDFGIARFYVDASSTTTASTSSIGVKGTIGYIAPEYAHGGQISIAGDVYSFGIVLLEIMTGKRPTDPMFNDGLDIVSFVESNTHQMLHVIDANLSEECKDLPQGNKQHESAVYQCLAALLQVALSSTRPLPSQRMNMKEIASRMQAIKSSYI

Gene3D: G3DSA:1.10.510.10
7-177 no description

TVHCDLKPSNILLDDDMTALLGDFGIARFYVDASSTTTASTSSIGVKGTIGYIAPEYAHGGQISIAGDVYSFGIVLLEIMTGKRPTDPMFNDGLDIVSFVESNTHQMLHVIDANLSEECKDLPQGNKQHESAVYQCLAALLQVALSSTRPLPSQRMNMKEIASRMQAIKSS

HMMPfam: PF00069
IPR017442
7-167 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

TVHCDLKPSNILLDDDMTALLGDFGIARFYVDASSTTTASTSSIGVKGTIGYIAPEYAHGGQISIAGDVYSFGIVLLEIMTGKRPTDPMFNDGLDIVSFVESNTHQMLHVIDANLSEECKDLPQGNKQHESAVYQCLAALLQVALSSTRPLPSQRMNMKEI

superfamily: SSF56112
IPR011009
8-171 Protein kinase-like (PK-like)
Protein kinase-like domain

VHCDLKPSNILLDDDMTALLGDFGIARFYVDASSTTTASTSSIGVKGTIGYIAPEYAHGGQISIAGDVYSFGIVLLEIMTGKRPTDPMFNDGLDIVSFVESNTHQMLHVIDANLSEECKDLPQGNKQHESAVYQCLAALLQVALSSTRPLPSQRMNMKEIASRM

HMMPanther: PTHR24420
8-179 FAMILY NOT NAMED,FAMILY NOT NAMED

VHCDLKPSNILLDDDMTALLGDFGIARFYVDASSTTTASTSSIGVKGTIGYIAPEYAHGGQISIAGDVYSFGIVLLEIMTGKRPTDPMFNDGLDIVSFVESNTHQMLHVIDANLSEECKDLPQGNKQHESAVYQCLAALLQVALSSTRPLPSQRMNMKEIASRMQAIKSSYI

HMMPanther: PTHR24420:SF474
8-179 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

VHCDLKPSNILLDDDMTALLGDFGIARFYVDASSTTTASTSSIGVKGTIGYIAPEYAHGGQISIAGDVYSFGIVLLEIMTGKRPTDPMFNDGLDIVSFVESNTHQMLHVIDANLSEECKDLPQGNKQHESAVYQCLAALLQVALSSTRPLPSQRMNMKEIASRMQAIKSSYI

Seg: seg
39-49 seg

ASSTTTASTSS






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox