PRGWK00000441 (Solyc01g102840.1.1)

From PRG Wiki
Revision as of 11:14, 13 August 2012 by Cepabot (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search


Solyc01g102840.1.1
Author User:Wasan
Gene Type Contributed R-Genes
Gene Class Class:TN
Location SL2.30ch01
Location Start 83292451
Location End 83296999
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

ATGGCAACCCCACAAAACCGTTATTCTTTCCATGTTTTCTTGAGTTTTAGAGGCGAAGACACCCGGAAAAACTTTACTGATCATCTCTACACAGCTCTCATCAACGCTGGAATTCGAACTTTTCGAGATGATGACGAAATCCGCAGGGGAGAAAACATAGAATCTGAACTGCAAAAGGGTATTCGAGAATCCAAGATTTCACTAATTGTCTTCTCTAAAGACTACGCTTCTTCAAGATGGTGTCTTGATGAGCTTGTCAACATTCTTGATCGAAGAAAGAAAGAGGGTCATACTGTCTTGCCTGTTTTTTACACTGTCAGCCCTGAGGATGTTCAGAACCAAAGTGGAAGTTTTGCTGAAGCTTTTGTGAATCATGAAAAGAGAGGAAATGCAGAGAGTGGAGAGAAAAGAAAGGAATGGATGGAGAAGATGGAGAAATGGAGATTAGCTCTGAAGGAAGTTGCTGAATTGGAAGGAATGTGCTTAGCCAAAGAAGTAGACGGGCATGAGGCAAAATTCATCCAAAAGATCATTAAGGAGATACTCAAAAGATTGAATCGCACAGTACTTAGTGTACCTTCATACACAGTTGGACTAGAGGCTCGAGTGAAGGACATTAACTCATGGTTACAGGATGAATCCAGTGAAGTTGGCATTGGGATGATCTGTGGACTTGGTGGCGTTGGAAAGACTACTGTTGCTAAAGTAGCTTACAACTCTAATTATGATAGATTTGATGGGAGTTGCTTTCTTGCAAATGTCAGAGAAATCTCTGAGAAACATCCAAATGGTCAGGTTTATTTGCAAAAACAAATTTTCGAAAGTATTTTGAAAGGCAGAAAGGAAAAAATATACAATGCTGATGAAGGAATTGTCAAAATGAAAGATGCTATTGGCAACAAAAAGGTTTTTATTGTATTTGATGATGTGGATCAGCTGGATGTCTTAGATTCACTTATTGGAACAAGGGATTGGTTTTATCCGGGGAGTAAAATTCTCATTACGACAAGGTGTGAGAAACTATTGAAGTCCTATGAGAGGCACATGCTATTCAAGATAAAGGAACTTGGAGATGACGAGTCTCTAAAGCTCTTCAGTTGGTATGCTTTTGCACAAGACCACCCATTAGAAGAGTTCAAGATGCTTTCAACAGAAGCAATACAGCATTGCTGTGGGCTTCCGTTAGCTCTTTATGATTTGGGTTCATTTCTTTCAGGGAGAGGTACGGATATATGGAGGAGTAAATTGCAGAAATTGGAAGCAATCCCTCATAGCAGAGTTCAAAAGAATCTTGAGATAAGCTACAAGTCTCTAGATGATCATGACCGGAGGTTGTTCCTCCTTATTTCTTCATTATTTGTTGGGAAGGACAAAGATTATGTTATCAAATTTTTAGAGAATGGTGATTTGCACCCAACAGTTGGAATTCAGAACCTCATTGACAGATCCCTCATCAGCATTGATGACGAAAATAAGGTGATGATGCCTCCACTTATTCAGGACATGGGGAAAGAAATTATTCGTCGAGAATCACAAGATGATCCCGAGAGATTGTTGTGCAAATGGTTGAACCAATGCGGTCTGTCACATGACTTGACAGAAAACAGTGGAACTGATGCAGATGGAGTAGACCTCCAAGGCACGCATCTGCCAGAAGATGGTCTTGTCCCAGCACTTGGTCCTAATGCTGCAAAAAGACCATATTATCAAGATTTTCCAGAAATAGCTGTTCTGCCATACCTAGGTAATTCGTTGAAAAGGCGTTTTGTTGGACTTCTTTCGACATTCCCCTTATCTGGTGGCCTCAAAAGATTCTTCCCATGA


Protein Sequences

MATPQNRYSFHVFLSFRGEDTRKNFTDHLYTALINAGIRTFRDDDEIRRGENIESELQKGIRESKISLIVFSKDYASSRWCLDELVNILDRRKKEGHTVLPVFYTVSPEDVQNQSGSFAEAFVNHEKRGNAESGEKRKEWMEKMEKWRLALKEVAELEGMCLAKEVDGHEAKFIQKIIKEILKRLNRTVLSVPSYTVGLEARVKDINSWLQDESSEVGIGMICGLGGVGKTTVAKVAYNSNYDRFDGSCFLANVREISEKHPNGQVYLQKQIFESILKGRKEKIYNADEGIVKMKDAIGNKKVFIVFDDVDQLDVLDSLIGTRDWFYPGSKILITTRCEKLLKSYERHMLFKIKELGDDESLKLFSWYAFAQDHPLEEFKMLSTEAIQHCCGLPLALYDLGSFLSGRGTDIWRSKLQKLEAIPHSRVQKNLEISYKSLDDHDRRLFLLISSLFVGKDKDYVIKFLENGDLHPTVGIQNLIDRSLISIDDENKVMMPPLIQDMGKEIIRRESQDDPERLLCKWLNQCGLSHDLTENSGTDADGVDLQGTHLPEDGLVPALGPNAAKRPYYQDFPEIAVLPYLGNSLKRRFVGLLSTFPLSGGLKRFFP


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox