PRGWK00001568 (Sotub04g018040.1.1)

From PRG Wiki
Revision as of 15:10, 15 September 2012 by Cepabot (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search


Sotub04g018040.1.1
Author User:Wasan
Gene Type Contributed R-Genes
Gene Class Class:RLK
Location 4
Location Start 34904899
Location End 34908499
Organism Species:Solanum tuberosum
Approved true



CDS Sequence

ATGTTCGAAAATACCACACACAAATTAATTCCCTTGAAACATTCTAGTAACTGCATGGAGAAGCATATTTCCTTGTTGATACTTGTCTTTCTAGTTAAATTTTCTATATCAATTGCTGCCTCAAATGAGACAGACCAAAAAGCTCTACTAGCTTTCCAAAATCTCATTAGTCCTAGTCGTTTTTTGGCCATTAATTGGACCAAGAATACTTCTTATTGCTCTTGGTTTGGTGTCACTTGCAGTCCA


Protein Sequences

MFENTTHKLIPLKHSSNCMEKHISLLILVFLVKFSISIAASNETDQKALLAFQNLISPSRFLAINWTKNTSYCSWFGVTCSPKRQRVVALALPNLQLQGTISPCLANLSFLRVLNIGNNSFHGGIPYGLGHLPRLRVIDIQNNQLNGSIPTSLFQHRRVQVISLAFNKLHGEMWKGPWYVPELRVLDLTNNSLTGVIPPSVGNATNMINFSLFGNRVNGNIPKEIGNLSQLADLSLSDNQLTGSIP


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox