PRGWK00002511 (Xa3/Xa26-3)

From PRG Wiki
Revision as of 13:44, 24 January 2014 by Felice (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search


Xa3/Xa26-3
Author User:Felice
Synonyms Xa3
Gene Type Contributed R-Genes
GenBank ID HQ148675.1
GenBank Locus HQ148675
Gene Class Class:RLP
Organism Species:Oryza minuta
Approved Yes



CDS Sequence

GGGAACGAGAGGAGGGGGAGGGAGTAGGTCGAGAGGGAAGTCGGCCCGAGTGGAGGAGGGAGGTAAAGTGGACTTTACCAGAGAAAATGAAAGAGGGAGTTTGAGGGCTCAGATTCGAAATCCGATTTTGCGGTTTTCTCCGGGATTGAGACGAGAGGGGGAACACGAGACCAGGCACACGACAAGACTTGACCAAGAACAAAATTTTCGCAAATAGGGTTTTTAGAGAACTAGGTTTTCCCACTAACGCCACGACGAAACAGGCGTTACATATTTTTAACACAAAAAACATATTATCAAAATATATTCAATGTTAGATTTAATGAAACTAATTTGATATTTCAGATTTTGCTAAATTTTTCTATAAACTTAATCAAACTTAACAAAGTTTGACTAGAAAAAAATTCAAATGACTTATAATATGAAATGGAGAGAGTACCGATTTCTTGCGTTGCTGTTGCATCTGTATAAATCTCTCTGTGAGTGTGTGTTGTTATCTTGTTGCTTCTAAGTTCCCTCTGTTACATTTTCTGGTTGCAGTCCAGGTTCCCTGGAAGATCAATGCTGCTACAAGTAAAACATCCTTCTCCTCGGCAATGATTCCCCTTCACAATCACGCGAAGTGAGCCGAAAATGCTTCAATACGGACGTTCGGTGCGGATAAAAAATCGGACCCCACATGTAACCACTCATTTCTTATCCTCCCATCTCCTTCGTCTTTCACGCAGGGCGGAGAAGACAGCCATTGCGGCGTCGCCTTCGCGCTTCCCCTACGAAGCCAACCGCCACGCAGCTCCCTCACGCTTGCTCCTTCCTCCTCCACCTCTGACTGCTGTAGCATGCTGGGCGACGGCAGATGGTAAGGCCACCTTCCTCATGTCCCCCATCTAGATCCATCAATCTAGTTGGAGCGTGCTTTCTGTGCTTGGTAGCCGGCACCGCAATGGCGAAAGAAGAGGGGGAAGGAAGCACAGTTTGAAAGAAATGGAGTGCTTTTTGATGGGTCCGGTCACCGGAGCAGAGGAAGAAGATGGATCCAGCCATCGAAGTAGAAGAAGACAGATCTAGTCACCTAAGTGGATGAAAAAGACAGACGGTAGAGTTGTTGCAATCTATTGTATATGTTTGTTGCACTCTATTTTATTTACGTGTTTCACCCTCGTTTTATCGGATGTTGCACATGATGTACAATGTGTGTTTCTTCGATGTTGCAGAGTAGAGTCTTGATGTTGCGGGTAGTGTTTTTTCATTGTTTCATCTGATTGAAACATTCTTTACCAAGCGATGAAATATTTCTCATCGAGTAATGAAATATCTTAAACATCTTTTATTGAAACATTATTCATTGAGTGATGAAACATCTGAAATATTTTTTTACATGTGATGAAACACCGTCTGATTTGTAGTCTTTTTTTAGGTGATAATATCTTAATGCTATTTATTTATACCTAGCTTAGTGGTCCCAATCTAGATTGTTTCTCTCTGGTGGAATTTCGCTATGATTCTATACTGAAAAAAATTTCTTAGGAGTCTAACCAAGTTCGTCACAGGTCTTGACCAATCAAATTATTTGCTTACTTCTACATGATTAAGTGCATGCCTGCCTGCAATATACTACCTCCTTTTCAAAATGTACGATGCTGTTGACTTCTCGTATGACGTTTTCAAAATGTACGATGCCGTTGACTTCTCGTATGACGTTTGATTATACGTCTTATTCAAAAAATCTATTATATATTAAAAATCCATTAAACTTCCTACAAAAAGTCACCATGTGGCACTTCTATAAACACTCCTATGCCGCCACGTGTCATATCTCCAAATTAAGAGAAAATCTATAGATTCTGAAAAAAGGAAAAATATCCAACCATCGATTTCACTTAAATCGGTGATCCATTATTTTAGATCATTAGATTAGATCTATTAAATAAAGCAAATCCCTCCCTCCTAACTCCCGTATATGTACATAGAAGTAGAAAAAGAATACGTACTACCCTATTTTCCTGGAGAAAAAGGTCGAAAACAAAATACACTATTCATCAGGAAAAAAGCAAAAAAAAACATACAAACATATTTGTACGGCCACCTGAAGTAGTGAAAAAACACAGAAAAAAGCATACGTCCCCTCGCCTGATTGTAGAAAAACATTATATTATTACAATTAAATTTACAATGCTAAACTTGTATTAACTGTATATTTTAATTTGAGAAATAATTATTTTACTTTGGGTTTTATTCTAAATTTATATGTCACCCAAATAATCATAAAAAATATAAAACAACTAAAACTGATATTTAAAAATTACTGACTGGTATGAAATTATGATATGTTAAAATAAATTTACTACTAGATTTATAAAAAAAATAAAATAAAACTAATTCCATTTATTTATTTCATCATAAAAATAATAACAAAAATAACAATATTGATTATACCATTATACATAACTTCATAAATATGGATAACAAAATTATATCTATGATTATTCGAAGTAAATATTTTCTTTGTTATGAAACTTTGATAAGCTATAATAACATTAAAGTCCTAATAACATTATAAAATTGTCATATAAACTACTTTCATGTATTCATATTTTTAATTTTCATTGTGAATATATTGCAAGAAAGACAAGATACAAAGCTCTTGCTATGGTTCAACCTACACAGGTTATACGTGGATAACTTAAAGGTATCAATCATATGTCTCATTAATCTTGAATGTGTCAGCCCCACTTACAAATTCGTATCCACCAATTGCTAACGAGGTATTTGTGCATCATCTCATATATCTTAGATATGATGAGCATGTGTACCATTAGACGTATAATAAAGATAAAGGGCATTTTATAATATAGATTATATCATTCTATATCATTTTATAAACATACATAGCCAAAGTCATGTGTGATTTACTTTAAATCTAACTAAAAAAATCATGTCTACAATAATAAGAATCATAGAAATTTAAAAAACAGAAAAACTCAAGAGCATATACCCTAATAGTAAATAAAAATATCAATGGCTAATCCCTAGGACATATAAAATTATAAAGGTTTGTTAAACGTCCTATAGAACCCTCCTACAGTGTCTATTAAAGCCTTTAACAAATAAGAGAAAACTTTAAAATTCTTCTATAATAGACAAAGCATCCAACACTTAATCCTCATTAATTTAATGCTCCCATTAATTTTAGCTATTGGTCATGTCAATGGGTATGTGTATACACACATTATTTAATAAAAAAAACCATCCATTCAAGCGTGTTTTGTAATAGAAAATTATTTGAGATGTCAGGTGAGGTTGTAGTGACCTGTTGCAAGGTTCACAGGGTTGTAGCAAGAATGACCAGCATCAAGTTGCATGAGGTTGCCAGCCATCTAATGTATCACTAAAAGAGCCCATAGGAGATATTTGTGTTTTGTTGATTAGAGCCACAACCAAAAGAAGGCAACAAGAGAACCCCAACACAAATAATAATTTTTATGAATAAACCTTCTCTCAACTCAAGTATCTATGTAATATTATTTAAGTCGCATCAGCTTGAAACATGCATAATTTGATAACATGGTATATCTAGAAGGCTATATGTTAGAACATTCAATTAACCCACCTTAGAAATAATAATACTTAGCAAGAACTCATGCATGTAACAAATTTCTATCTTTAATTTTGATATTTAATTTTATCACTGAAAAGGGGGAGATAGAGTATGTGAATATTGTCCAATTTGCAAGCTAAATGTTTTTTTAAATGTGATAGTTCAGTTGGTTACTGATTCTCAAGTATTATCATACTATTCAAGAGTAGAGCAAGCAATAATCATATCCAAAACAGATACAAAGAACTTACATATCATAGATAATTTTAACATTTAGAAACACGAAGATGCCTGCCCAACCGCGTGGGCTACCTTCCTAGTTAATATAAATATGTAAAGGTATAACTTAAGATTATAATTTATTTGATGATAAAACAAGTATTTATGTATATATATATATATTTAATAAAATGAATGATCAAACGCTATACGAAAAATCAACGGCGTCGTGCATTTTGAAATGGAGGAAGTATTTTTTTCGAGGTAATCGTTATGTTTGAGGAAATGTGGCATGAGTTCACCACTTGCCAACTTGGAATATAACACATCGTATCGTTAGTGTTCCATGCACTAAAAGTCTCTTTCTTTCCCCTTTGGAATGAGAACAATATAGCTTGGTAATACTGTTCATCTTATTCGCCTTTTTCCTCCTTTGGAAAGGGACAGTTGAGCGGTGGTCTGGTGGTTACATCTAAAACATGCCATGAGAAGCTTTGGCACTGTGTGTCTTGTGCTTCAAATGGCTCGACATTACAACCTAATAAATCTGAACACTTTGTTCCATCTTGGACTTCAGAGCACTGGTACTTCAGTACATGCCCAAGGGTAGCTTAGAAGCACTCTGCACTCAGAACAAGGAAAGCAATTAGGCTTTCTCCAGAGGTTGGTTATTATGCTAGATGTGTCAATGGCAATGGAATACCTACATCATGAGCACTATGAGGTGGTCTTACACTACGATTTGAAGCCTAGCAACGTACTATTTGACGATGATAGGATGGCACATGTGGCAGACTTTGGCATTGCAAGGTTATTGTTAGGTGATGACAACTCCATGATCTCAGCTAGCATGCCAGGAACAGTTGGGTACATGGCACCAGGTAATTAGTACTAGTTTTTGTTGTCTTGCTCAAACATTGCCTGATATTTTATTATTATCGAGTAGGGTGCAACTAATTTTTGGTTGTCTATCTTTCTGCGCAGAGTATGGGGCTCTTGGAAAAGCATCACAGAAGAGCGACGTGTTCAGCTACGGGATCATGCTACTCGAAGTGTTCACTAGGAAGAGATCCACAGATGTTATGTTTGTAGGAGAACTGAACATCAGGCAGTGGGTTCACCAGGCGTTTCCTGCAGAGCTTGTCCATTTGATGGACTGCCAACTTCTACAGGATGGCTCTTCTTCTTCTTCCAGTAACATGCATGGCTTCCTTGTGCCAGTGTTCGAGCTGGGCTTGCTCTGCTCAGCTGACTCCCCGGAGCAAAGGATGGCGATGAGCGATGTGGTCGTGACACTGAAGAAGATTAGGAAGGACTATGTCAAATTGATGGCAACCACAGGGAGCGCTGTGCAGCAATGATCCATCGCTCTGTCGTGGTATATGAGCGAATAAAATATATATCATTTGCATCCATTTCTTCTTCTGCATCAGGAATAGCATCAGTGCATGCCCAGTGATCGATTACCCTATTTGTGTACGGTTGAATTGAATATATCTGTGGTGCTTCAGGTTCAGCAATAATTTAGTTGGTGTAAAAATGTGATTGAACTGTTGGTCAATAAATTTGCATGATGAAAATGGGAGTAGATGATGTGCTGCTTATGTTTTCTTATTTCTGGCCAAAATAAATAAAAAAAAGAATATTCTGGGCACAGCATCACAACTCCGGCTCAATCAGCCTTAAACAGCCACAGTTAACAGTCCTAAGCATAGAAACTTAACAAGCTTTTCAGGCAAACAAAACATCAAAAGGTCCACAAGACAACAGGGTCTTCAGGGAGCACATCTTCAGGCTGTGATGCAAAAAGGATCTGACAGCCGTATGATAACTACTGAACAGGTCGTGCATATTGATAAGGTCCGCCACTAACCACCCAATCAACAAAAGAGTAAGGCCGTTGCCGTCAAATTGTTTGACAGAAAAAAAAAATTTCAGTGAGTGTATGGCTGATGACCGAGCGACACAGCTATCATATCTAGCGTGTCGTGCACACCGCGATCTGCTGAATATATATTTTGTGATGACTTTATTTTCCAGCGTTTACCTAGTAGTGCTGCCAAATATTTATGACTGGAATTTGACTGGAGGGAGTATCATTTAAGTTTCTTTCACTTTCTGAGAGCAACAGTCAAGGTCGTCCGAGATGTTGAAAGCAAGCTAGCACTACGTACTGTGCTAAATAAAGCTCAACTTGATCGTCACTGTGAAGTATGATGCACTCTTGTTGCCAATGCATCACACACAACCAGACATGGCGCTTGGATTGCCAGTATGGATTTTCATTGCGTTGTTGATCGCTTTGTCCACTGTGCCTTGTGCTTCCTCTCTAGGTCCGAGCAACAGTAGCGGCAGTGACACCGACCTCGCTGCACTTTTGGCTTTAAAATCGCAGTTCTCTGATCCTGATAACATTCTTGCCGGCAACTGGACCATTGGCACGCCATTCTGCCAATGGATGGGTGTCTCGTGCAGCCACCGCCGGCAGCGCGTCACCGCCCTGGAACTGCCAAACGTTCCTCTCCAAGGAGAGCTCAGCTCTCACCTTGGTAACATTTCTTTTCTCTTGATCCTCAACCTCACCAACACCGGCCTCACAGGCTTGGTGCCGGATTATATAGGAAGGCTACGTCGCCTTGAGATCCTTGATCTCGGCCACAATGCCTTGTCAGGTGGCGTCCCAATCGCCATAGGGAACCTCACGAGGCTTCAGCTACTTAATCTACAGTTTAACCAGCTATATGGTCCAATCCCAGCAGAGCTGCAGGGGCTGCACAGTCTTGACAGCATGAATCTCCGTCACAATTACCTCACTGGATCAATTCCGGACAATCTGTTCAACAACACATCTTTGCTAACTTATCTCAACGTTGGTAACAATAGCCTGTCAGGACCGATACCGGGTTGCATCGGTTCCTTGCCAATCCTCCAATACCTTAACTTGCAGGCCAATAACTTAACTGGGGCGGTGCCACCAGCCATCTTCAACATGTCTAAATTAAGTACTATTTCTCTTATATCGAATGGTTTAACTGGCCCTATCCCTGGTAATACAAGTTTCAGCCTCCCAGTTCTACAATGGTTCGCCATCAGTAAAAACAATTTCTTTGGTCAAATTCCACTGGGGTTCGCAGCGTGTCCATACCTCCAAGTTATTGCCCTGCCTTATAATTTATTCGAGGGTGTTTTGCCACCATGGCTGGGCAAGTTGACGAGTCTTAATACCATCTCCTTGGGTGGGAATAACCTTGATGCTGGCCCGATCCCTACTGAACTTAGCAACCTCACCATGCTGGCAGTCTTAGATTTGACGACGTGCAACCTGACAGGAAACATCCCTGCAGATATTGGGCACCTAGGCCAACTTTCATGGTTGCATCTTGCGAGGAATCAACTAACAGGACCTATTCCTGCTTCTCTTGGCAACCTTTCATCGTTAGCAATCCTGCTATTGAAAGGAAACTTGTTGGATGGATCATTACCAGCGACAGTTGATAGCATGAACTCACTAACTGCAGTTGATGTTACTGAAAACAATCTACACGGAGATCTCAACTTCCTTTCTACTGTTTCCAATTGTAGAAAGCTTTCTACCCTTCAAATGGACTTTAATTATGTCACCGGAAGCCTCCCAGACTATGTTGGGAACCTGTCGTCACAGCTGAAATGGTTCACGTTATCTAACAACAAGTTAACTGGCACGCTTCCAGCTACCATTTCAAATTTAACTGGTCTTGAGGTGATAGATCTTTCGCATAACCAACTGCGCAATGCAATTCCAGAATCAATCATGACGATTGAGAATCTCCAATGGCTTGACCTAAGTGGAAATAGCTTGTCTGGCTTCATCCCATCGAATACTGCACTTCTAAGGAACATTGTAAAACTATTCCTTGAAAGCAACGAAATTTCTGGCTCCATACCAAAGGACATGAGAAACCTCACTAATCTAGAGCACCTTCTATTGTCTGATAACCAATTAACGTCAACCGTGCCACCAAGCTTATTTCATCTTGATAAAATCATCAGGCTAGATCTTTCTCGAAACTTCTTGAGTGGTGCACTGCCGGTTGATGTAGGGTACTTGAAGCAAATTACCATCATAGATCTCTCTGACAACAGCTTTTCTGGCAGCATCCCAGATTCGATAGGAGAACTTCAAATGTTAACACACCTGAATCTATCAGCTAACGAATTCTATGATTCTGTTCCAGACTCTTTTGGTAATTTAACTGGCTTGCAAACTTTGGACATATCCCATAACAGTATTTCTGGTACCATCCCAAACTACTTGGCTAATTTTACGACCCTTGTTAGCTTGAACCTATCTTTCAATAAACTACATGGTCAAATACCGGAAGGAGGTATCTTTGCAAACATCACTTTACAATACTTGGTGGGGAACTCAGGGCTATGTGGTGCTGCCCGTTTAGGATTCCCACCATGCCAAACCACCTCCCCCAAGAGAAATGGTCACATGCTAAAATACTTGCTACCGACTATAATCATAGTAGTTGGAGTTGTAGCTTGTTGCTTGTATGTAATGATTAGAAAGAAAGCTAACCATCAAAAGATTTCTGCTGGTATGGCTGACCTTATCAGCCATCAATTTCTGTCCTATCATGAGCTTCTTCGTGCAACCGATGATTTCAGTGATGATAACATGTTGGGCTTCGGAAGCTTTGGAAAAGTTTTTAAGGGACAGTTGAGCAACGGTATGGTGGTTGCCATAAAAGTTATACACCAGCATCTGGAACATGCCATGAGAAGCTTTGACACCGAGTGTCGTGTACTCCGAATTGCTCGACATCGTAACCTGATAAAGATTCTGAACACTTGTTCCAACCTGGACTTCAGAGCACTCGTACTTCAGTACATGCCCAAGGGTAGCTTAGAAGCACTCCTGCACTCAGAACAAGGAAAGCAATTAGGCTTTCTCAAGAGGTTGGATATTATGCTAGATGTGTCAATGGCAATGGAATACCTGCATCATGAGCACTATGAGGTGGTCTTACACTGCGATTTGAAGCCTAGCAACGTACTATTTGACGATGATATGACGGCACATGTGGCAGACTTTGGCATTGCAAGGTTGTTGTTAGGTGATGACAACTCCATGATCTCAGCTAGCATGCCAGGAACAGTTGGGTACATGGCACCAGGTACTTAGTACTAGTTTTTGTTGTCTTGCTCAAGCATTGCCTGATCTTTTATTATTATCAAGTAGGGTGCGACTAATTTTTGGTAACTAACTTTTCTTGAGCAGAGTATGGGGCTCTAGGAAAGGCGTCACGGAAGAGCGATGTGTTCAGTTACGGGATCATGTTGTTTGAAGTGTTCACTGGGAAGAGACCCACAGATGCTATGTTTGTGGGAGAACTGAACATCAGGCAGTGGGTTCACCAGGCGTTTCCTGCAGAGCTTGTCCATGTGGTGGACTGCCAACTTCTACATGATGGCTCTTCTTCCAGTAACATGCATGGCTTCCATGTGCCAGTGTTCGAGCTGGGCTTGCTCTGCTCAGCTGACTCCCCGGAGCAAAGGATGGCGATGAGCGATGTGGTCGTGACACTGAAGAAGATTAGGAAGGACTATGTCAAATTGATGGCAACCACAGAGAACGCTGTGCAGCAGTGATTCATCACTTTCTTGTGGTATATGAGCGAATGAAATGTATATCCTTTGCATCCATTTCTTCTTCTGCATTAGGAACAGCATCAATGCATGCCCAGTGATCGAATAACCCTTTTGCTTCTATTTGTGTATGGTTGAATTGAATATATCTACGGTGCTTCAGGTTCAGCAACAATTTAGTTGGTGTAAAAATGTGATTGAACTGCTGGTCGATAAATTTGCATCATGAAAATGAAAATGGGAGTAGATGATGTGCTGCTTATATTTTCTATTTCTGGCCAAATATATATAAAAAAGGATATTCTCACTTGAAAACAGAATGAGGTTTGCTTTGTAGACATTGGGCCTTTGTCGTGGGCTTCACTGGTACCCTGACATGCTTTATAGCCCATGGGCCTATGTTTGTAATGGGCTTTTGTTTCTTTCGAATGACTCAAGGTATATTAAGGCCTGTTTGAACACTTCGGAATATTTTGCGGTGGTAGAGGTGGACACTAAACGACGACATAGGTAAAATGATATATAGAAACAAAATTAATTCAAACGATATACTCATGCTATAAATTTGAGATATGGTAATTAATAAAACTTCACATAGGCGACGAACCGTATATATAACAGTTAATGCATAATAATGGCAGAGATTTCGTAATGAATCCTCCAAGATTTACTCTTGCGACTCTATATAAACAGCTGCAAAATGAAGCTAGGTAGTCAGCATATGCAGTAGCTTCCTTCTAAAAGAAGATCTCTCATCTCATCATGGAGCAACTTCTCAACAAGAAGGCTGCAGTGTTCTTGTTCATAGCTCTTATGGTGATGGCTACCGTAAATTTCTCATCCTGTCATACTACACAAGGTATATACCTCTGGAATTAATTTCTGCATCACATCCATATATATTGAAAACAGTTTAACTTGTTCTCTTTTGCAATGGCTCCATCACATCAATGAAGCTAGAATAATCTGATATAGCCTGACAAGTATATGTGCATTTTACATTTTCTGTATGAACTATTTTAGCTTTCTGTAAAAGTCGGGTCATTAACAATATAATGATCTTTTCTCTAAAAACATGCATTTTACATGTGTATATATATAGGTGGATATGGAGAAATGGATTCGTGCATGGTCCTTGAACGTTGCGATATGAACAAGTGCATGAGTGCCTGCCAAGTCAACAAGTACAACGGAGGTCAGTGCGACGGCGAGTTGAACGACCACTGCTGCTGTACTGATGAGGCCCCGCACAAATAGTAGATTTCTCTTGTCCAAATCAACGACGACGGTTGTATAATCAACGGCAATCTTATTATTGACTGATGCAGAGATTCCATAATAAACTTGCAGTTGATGCTTGTACCAATTCACTCAGTATGTCAATTAGTAAAAGGAGAATCCCGCGCAAATGTGCGGGCAACTTATTTATTCTTTATTAAAAGAATAAATTTTATTTAAAGACTATAGATTATCTTATGTCATTAAAAAAGAAATATCTCTACCCTGAAATTGACCATAGACTTTGATACACTAAAGTAACTTATAAGAATATCTCTCATATTAAAAAAGATCACTATGTCTTGGTTATATATAAACTTTCCTATCACAACTACTTATTATTCTCTCGAAAAAGCTAAGTATGTTTTTAATAGATAGAATTGCTTATTAAAAAACAAACATAATACATCATTAATGCAATAAAAAAATCATCTCTATTTCATTCCGAAGTGCACATGTCTCACTTGTGTCTGAATGTATAAATATTTAAAAATGCCGTTTCTGTCAATTAATGAAAGAAAACCATTAAAATTAGATATAAATACCCATATAATGTGTGAAGTTGGTCATAGCTGCTAAGGCTTTATTCTCTAATGCCTTGAAACATGGGTCCTGCATTGACGTAGCCGTGCCCCTCAAGACTACGTCGATCATAATTTTGACACCTAGCTCACTCTCTACACATTTATAAAGAATTGTATTAGTAAGTAGGCTAGTTGAGCTCTACCTCCAAGAGTGAAAGAAGTCATAGGGGATTCGATGGACTGATCCTATGTATGTGTGTACAAACATAATAACATTTTAGTTTTAAATTTGAGGATTTGGAGGGAAAGATTAATATTTTTTCAATTGTACATGCATACATATATTTTTTTCTAGGGTTTTGGATGAACAGTACTTATTTTTCTGTGGTAGTGGTACTTACATGGGAGATTAACAGGGAAGGATCACTTTAATACATCTAATCTAATATTTTAAAATAATGGGTATATTGGTTTAAGTATAAATCAATGGTAGATGTTTTGCTTTTTTCTCATATTTTTTTATATTTTCACCAATTTATTAGAGCATCAGGTTGTTGCCTTAGGAGCGTTTGTAGAGATTAGGTGGGAGTGATTAGTTTAACAGATCTAATCTAATAATTAAAAATATTGGGTCAACCCATTTAAGTATAATCAATCGCTAGATGTTTTACTTTTTTGTTAGGATTTCTTGGATTTTTTCTAATTTATTAGAGCACCATGTGATGGTTTAAGATTGTTTGTAGCAGTGCCACATGGTGGCTTAGAAGCGTTTGTATGATTTTCAATGGACTTTTAATATATAATAATATTTTTGTCTCAATGATTGGTGGATAGCACTGCATATGTAGAATTGATACATGAGTTTGAGTCTGACATAAAATTAACACATAAGGTAAGACATGCATGAGTCAAATACATTGGATCTTATTTATTATATACCCAGATTAACTTAAGTTTAAACTGCAGAGACTGAAGAGAAAAAGATCAACATATATGCCTCCTATTACTCTTAATTAAGACATATCGATCCGGTTCATTTAATCATTTATTTTCTATAGTCCTTTACAATATATCTAGATTTATATTACTGTGATAATTGATATTTTAAAGCGAAGATAATATTTTTTAATGGTAATCACAATTAGAGTATTTTAGTTTGGAACATTGTAGATTGCTTTAAATATTAAAGTTATGATGATGTCAATCATGAAAGATTTAAGTAAAGTTATTTTGTTTTGTGAAAAATAATATTGTTTTAACATATAAATATTTTAGAACAGTGGTATTATTTTTTGGGAGTGCTAATCAAAACTAATTAGAATATTTTATTTTGTGATATTATTGAGCTAATCTAATTATGCATGATTGTGAAATGATATATGATGATATGATCTACATTATCTATTTTCTTCACAACCTTTTTTATTGTTGGGATGACATGCAAAAGGTTAGGGTATGATTTAAAATACTAGAGGGAATATTTTTTGGAACGTCACTCACGATTTAAGTGTTTTTGTTTTTTCATATCTATCATATTTAATTTATTTGTGCATGTTTTATAAAGTGATATATGATCATATAATATACGTTGTCATTTTTTGTATTTAACAGCTTCAATTGCATACTAAGGTTAGGATGTGATAAAAATTAAATATTTTTTATGAGTTAAAGAATGTAGTGGCTTATATGGGTATTTGAATGGTTAATTAAGCTTCATGAATACAATTATAAAGAATGATAAAAAGATTTATGTGCACTAGAGGAGGGGGAGGGGGAGGGGGAGGGGAAGGGGGGTGGGTTGGTGGGGGAGAGGGGAGGGAGGTGTATTGTGGGGTTTTTTTTAAAAAAATAAATCTAATAGATAAATATAGTGGGCCTACCGATCTAATAGATAAAAATAGTAGGCCTACCGATTTATTAGAGAGTCATATGGCAACTTAGAAGCATTTATAGAAGCCCCACGTGACGGCTTGAGAATGTTTAGTAGAAGTTTAATGGACTAGGGTAATAGCTAGTGTGTTTATCTTCATGAAATCTTCATCGGCTGCTTCTAGTAATTTGCTTTAGACATGTTAAAATAGGCCGATGAGATTAGATCTGTTTCAATTTATTTATTATCTTGAGTAAGCCGATACAGCTTTGCCCTATCGGCTGGGTTATAACAATGTGTCATCGGCTTATCGGCCGATCGACCATTGTTTTCTGATATGGTTTACTTGTTTCTTGTTGATTGCAGATCAAATCAACTGGCACGCTCTGCGTACGACTAGGCAAGCCAATTTGGACCTGCACTGGAGTTAAGCAGATCTCCCAGACCGCCGTGGTAACGCGGAACCCGTTTTGTTGCTAGACGGGTCCAAATTCTGCGCCAACAAACCCCAAGTACTAAAGCAACACCCG


Protein Sequences

  • Name: leucine-rich repeat receptor kinase-type protein [Oryza minuta]

MALGLPVWIFIALLIALSTVPCASSLGPSNSSGSDTDLAALLALKSQFSDPDNILAGNWTIGTPFCQWMGVSCSHRRQRVTALELPNVPLQGELSSHLGNISFLLILNLTNTGLTGLVPDYIGRLRRLEILDLGHNALSGGVPIAIGNLTRLQLLNLQFNQLYGPIPAELQGLHSLDSMNLRHNYLTGSIPDNLFNNTSLLTYLNVGNNSLSGPIPGCIGSLPILQYLNLQANNLTGAVPPAIFNMSKLSTISLISNGLTGPIPGNTSFSLPVLQWFAISKNNFFGQIPLGFAACPYLQVIALPYNLFEGVLPPWLGKLTSLNTISLGGNNLDAGPIPTELSNLTMLAVLDLTTCNLTGNIPADIGHLGQLSWLHLARNQLTGPIPASLGNLSSLAILLLKGNLLDGSLPATVDSMNSLTAVDVTENNLHGDLNFLSTVSNCRKLSTLQMDFNYVTGSLPDYVGNLSSQLKWFTLSNNKLTGTLPATISNLTGLEVIDLSHNQLRNAIPESIMTIENLQWLDLSGNSLSGFIPSNTALLRNIVKLFLESNEISGSIPKDMRNLTNLEHLLLSDNQLTSTVPPSLFHLDKIIRLDLSRNFLSGALPVDVGYLKQITIIDLSDNSFSGSIPDSIGELQMLTHLNLSANEFYDSVPDSFGNLTGLQTLDISHNSISGTIPNYLANFTTLVSLNLSFNKLHGQIPEGGIFANITLQYLVGNSGLCGAARLGFPPCQTTSPKRNGHMLKYLLPTIIIVVGVVACCLYVMIRKKANHQKISAGMADLISHQFLSYHELLRATDDFSDDNMLGFGSFGKVFKGQLSNGMVVAIKVIHQHLEHAMRSFDTECRVLRIARHRNLIKILNTCSNLDFRALVLQYMPKGSLEALLHSEQGKQLGFLKRLDIMLDVSMAMEYLHHEHYEVVLHCDLKPSNVLFDDDMTAHVADFGIARLLLGDDNSMISASMPGTVGYMAPEYGALGKASRKSDVFSYGIMLFEVFTGKRPTDAMFVGELNIRQWVHQAFPAELVHVVDCQLLHDGSSSSNMHGFHVPVFELGLLCSADSPEQRMAMSDVVVTLKKIRKDYVKLMATTENAVQQ





List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox