PRGWK00002525 (RDC0002NLR0012)

From PRG Wiki
Revision as of 15:11, 8 April 2014 by Cepabot (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search


RDC0002NLR0012
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS, Domain:LRR
Location Start 34946115
Location End 34948700
Organism Species:Solanum lycopersicum
Approved true



CDS Sequence

TCAAATTTCCAGCTTCTCAAGGTTACTCAATGATATCAACTCTTCAGGGAGCCTACTCAACGAGTAGCATTTGAAGATTTGCAGGTATTTGAGTCCTGCCATTGCACCTTTCCCTAGCTTCATCTCTTGTATAGACATTAGTTGATCCATCCTGAAAAACCTGAGTCCACGAAACCCATTCTCTGATATTGTTATACTGTCATCTTGCTGATCATATCGGTCAAAAGCTTTAACTAGTTTTAGAACTGACAAGTTGGTTAACTTCTCCAACACTTGAATTGACTCTGGATGGAGATTGGTGTTCACCAAAGTTAGCTGACAAAGCTTAGGTGGAAATACGCAAAAATTAACTGGTATTGATGCTAAGCCTCCCTTCAACTTAAGCTTGACAACATGACTCAACTTAGATAAACCAGCAACCAAATATATTTTCCTGCTACCCTCTACTTCCAAACACAAGGATTGAAGGCTCTTAAGCTCTGCAAGTGAATTACATAATTGATTCATGTCTAGGTTATCAGCACTTCCAATGAGAAAACCAACTTTTTGGAGCTGAGTCATTCTAGTCAGGTTTTTATGGTGCATCCAGTGATGAACAGGTATGCTGCCTAGAGTTTGGAGATTGTTAGGTAGGTCAATCTTCAATAGGCTGGGGGAATTTATGTAACCAAGTATATGCCGTAAGTTCTCTAACTTCCATAAGACATTAGGAACTTTCACAGAATAAAACCTAGACATGGGCATATCTATTGTTTCCAAGTTTTGCAGACGACTTATCGAATGGGGAAACTTCTTAATACATGTCTTCCATCCTATGCCTAAGTACTTCAAGGAACATAGTTTCCCAATACTATCTGAGATCACATTTAAACCAGGAGAGTCTATGTATAGCACTTTGAGAAGTTTGAAACTACTTGTACAAATACACTTTAGGTTAACTAGTTTAGCAGATGAATCAAAGCATAGAAGGGATCTTATATACGATTTTGAATTTCCCAAATATTCGTACCTCTCGAGTGGAGTATAAAGGACACGGTGCCAAGATTCAGAGAGGGATATAGATGGATTATCTACCTCGAGAAACATTTCTTCCTTGGCCTGCATTATATAAAAGTCTCGTAGGAGATCATGGAGCCGGCAACTTTTGACTCTGTCATCTGCTCTAACTTGGATTACTTATAACATATTTCTGCCAATGAGATCATCTAGATAATCCTCCACGATGTCCTCTAACTTTTGTTCTCCATTTTGATGAATAAGACCATGGGCAATCCATATGTGCACGAGTTGCCTCACAGGGATGTCTTTGCCTTTTTGGAGAAGGCCTAAGTAAAGAAAGCAAGATTTTAAATGGGGAGGTAAGTCTTTATAACTCAATGCCAAAATTGCTGATACACCATAACTTTGACTTCCAACGAGGTGTAAATCGAGGTTTCGTTGTACTCTCTTACCAGCCAAGAGGCCTCCAATGACAGTGATTGCCAGTGGCAAACCGTCACATTTTTCCAGAATCTCTTTCCCCACGCCCACCAAGTCATGTGGAAACTCTCTATCCTCGGCATTTTCTATCTTGAGAAAGAGTTCCCAGCTCTCCTCTTTACTCAAATACTTTATGTTCGTAAAGTGTAGTATGAGCATCTGCATGCAAGGCAACCTCCTTACTGCGGCTGGTAAGTAGCAATCTACTTGACTTATTGTTGTCAGGAAATGATCTAACAATGAGATCCCATGCTTCTGTGTCCAGATGTCATCAAGAACAATGAGATAGCATGTATCTTTCAAACGCCTCTGGAGCATTTCCTCCAAACCAGCCTGTGACAATTTGTCCATCGTATCGACTATCTTCACTTTATCTTCTTCTGGACTTGCCAGTTGTAAAATGAGTTCCTTGATGATCTTCATGGGCTTATAATCTTGGGATACATAAAGCCATGCCCGAATGTCAAACTTTTCTCTGATTTGAGTTTGGTTATAAACTTCCTTCGCGAGAGTCGTCTTGCCGACGCCCCCCATACCAACAATTGAAGCAACACGAAGCCGTTTGTCCTCCTTCAGAAGATTGACACGACAGAATTCACATGCTTCTCTAGACCAACAGTATCTTTATCGGCAATCAAGGGCGAGGAGAGTCTTCGTTCACGCATCTTCTCACGTGTTGTGCTTGAACCTTCCCCATCTCTGAGACCTTGAATATGCCTGATGCCATATCTTTCAAGACTGTTGGATATTTCAAGTATTCTGGTCTGAATTGATTCAATCTCTTTCCCTACTTTGTAAAGACCGTATAGTTTCTTAGGATAGAAGATACACTTGATGAAGAAACTTTGACGTTTTTGGGACTCAACTTGTTGGATGAATATTTCAATGACATCCTCAGCATGGTAGGCAACTGCTCTGATTTCAGATACCCAATAGCGGATTGTTGCGGCTTCATCTTCCTCTTGCTTAATATATCTGCATCTTTCAGGAAACACTTCATGCGCACAAGCTCGTTTCACACTCCTTCAATTCCTTGTTGGACGTTTTTCAGGAAAACAATTTTTCTCTGGAAAGATCTAGAAGCCGCTCTGCAACATAGGAAACTGC

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox