PRGWK00003186 (RDC0003NLR0347)

From PRG Wiki
Revision as of 15:36, 8 April 2014 by Cepabot (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search


RDC0003NLR0347
Author User:GiuseppeAndolfo
Gene Type Contributed R-Genes
Domain Type Domain:NBS
Location Start 3888
Location End 4289
Organism Species:Solanum pimpinellifolium
Approved true



CDS Sequence

ATGTTAAGGGCAAGAGGAAGAACAGAACATGCATGGAACAGAGTACTTGACAGTATGACTCATAAAATTCAAGAGGGATGTGCTAAGGTATTGGCTTTGAGTTACAATGATTTGCCTATTGCATTAAGGCCATGTTTCTTGTACTTTGGCCTTTTCCCCGAGGACCATGAAATTCGTGCTTTTGATTTGATAAATATGTGGATTGCTGAGAAGCTCATAGTTGTAAATAGTGGTAATACGCGAGAGGCTGAAAGTAAGGCGGAGGATTTCCTAAATGATTTGGTTTCTAGGAACTTGATCCAAGTTGCCAAAAGGAGATATGATGGAAGAATTTCAACTTGTCGCATACATGACTTGTTACATAGTTTGTGTGTGGAGTTGGGCAAGGAAAGTAACTTCTTT

Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox