PRGAV00000029 (AvrBs2)

From PRG Wiki
Jump to: navigation, search


AvrBs2
Gene Type Avirulence Genes
GenBank 108946643 (DQ641035)
Gene Species Xanthomonas campestris

Comment?

Description

Xanthomonas oryzae pv. oryzicola AvrBs2 (avrBs2) gene, complete cds

Sequence

GCAACGCAGGCATCGTTTCGCATCCTGGTGGCATATTTCGCCTCGGGTGCGAATTGTCATATTTCATGCGGTCTACTGACCGCCCGCCGCGTTTTTGAGGTCATTTACGCGTATAGGTCCTCCGCAACCGTCCATCGCTCACACTGCCGCGCTGGCGATACCGACGCACACCAGTGAGAGCAGCCCGACGCAGGTGCCGCACTTGCAGGGCAACACCCCGCCACTGCGGGAACGTGCGCGTCGCCGCGCCGTCAGCGTACCTCCGCTGGTGTCATTGAACGACAGCGCGATGACCGGCAAGCCGGCCTTGGTGGCGTTGGACAGCGAATTCTCAGAGCAGCGCCTGGCCGAAGTGCAGGCGCGGCAGATCACCGTGCAGGCACTGCAAGGCAAGCTTGCCGCGCATCTTGCGCAGGCCGGCACGGCGCTCACGCCCGACAGCATTGCCGCACGCTTCGCCGCCGGCGCACTGGAGCCGGTGTATCTGGATACGGCTGCATTCAATGCCATGTCGCGCGGGTTGCCCGCACGCGCACGTGCGGCGGCCGGTCCCGTGCTGATCGATGCGCAGCAGGGTCGCATCGTCTTCAATCTGCAGCGCGCGTTTGCGTCTGGCGACACCTTCAGCGACGCGGCGCTGACCGCGCTGGGCAAGGCGCTGGATCTACCCGGCCACGGGCTGGCGACGCCGGACTGGCCGCAGCCCGCCGCACGCACGCCGACGCGGCGCAAGTTGGAGCACGCCCCGCGCTACCACGGTCACGAGGTGCCGGCGCGCGACGGTGGCGCTGCGTTCTTCAAGGCCAACGACCATCGCCTGCTGGAAGGAAGGCAAGCGCTGTTGCGCAATCATCGAAAAGCGCTCGTGCACGACCACTACTTCGAAGCACCCAGCACGCGTGCGTTAGGAAAGGACGTGATGGTGCATCGCGGGCTGTTCGATAACCACGCCGGCATCCCGGAAAATTCGTTGTCGTCCATCGATAATGCTTACGCGAAGGGCTATCGTAATCTGGAGCTGGACGTCGAAGTCAGTGCCGATGGAGTACCGGTGTTGATGCACGATTTCAGCGTGGGCCGCATGGCAGGCGATCCGGAGAACCGCCTGGTGTCGCAGGTTCCGTTTGCGGAGTTGCGTGAAATGCCGTTGGTGATCCGCAACCCGTCTGACGGCAACTACGTCAAAACCGACCAGACCGTCTCCGGCGTGGAGCAGATGCTGGAACACGTGATCAAAAAGCCCGAGCCGATGTCGGTGGCGCTGGATTGCAAGGAGAATACCGGCGAGGCGGTGGCGATGCTGCTGATGCGCCGGCCGGACCTGCGCAATGCTGCAGCGATCAAGGTCTATGCCAAGTACTACACCGGAGGCTTTGATCAATTTCTGTCCAATTTGTACAAGCACTACCAGATCAACCCGTTGCACTCTCAGGACGCGCCACGCCGCGCCGCGCTGGATCGCTTGCTGACCAAGATCAACGTGGTGCCGGTCTTGAGCCAGGCCATGTTGAACGACGAGCACTTGCGCGGTTCCTTTCGGAGCAATGACGACGGCGCGGAGGGCCTCGCAGACACCGCAATGCAGTGGCTGGAAAGCTGGACCAGGATGCGCCCGGTGATTGTGGAGGCAGTGGCCACCGACGACAGCGATGCGGGTAAGGCCATGGCCATGGCGCGTGGGCGGATGCGCCAGCCGGACTCGGCCTACGCAAAGGCCGCCTATTCGGTGAGCTACCGGTTTGAGGACTTTTCCGTGCCGCGCGCCAATCACGACAGGGACTACTACGTTTACCGCAACTTTGGCGAGCTGCAAAAGCTCACCAACGAGGAATTCGGCGTCAAGCGCACCACGGCCGGCGCGTTCCGCGATGACGGCGAAAGCCTGCTGACCGACCAGGCCGAGGCGGAATTGCTCGCCATCCTGGAAAACCGCACGCTGGCCCGCGGCCATACCGGCAACGAACTCGACGTGCCGCCGGAAACGCCTATCGATGTCAACCGGGACGCCGAGATCGTGAAGCAACGCACCCGCGAATTCCAGGCTGGCTTCATCCCCGCCGACCCGAACCACATCGCAGCGGTTCGCGAAGGCAAACAACGCGATCACAGAGCAGACATGGTGCATGACCCTGCAGAAACGCGTGCGGTGGATAAGCGCGCTCAAGCGTCTGGTTTGTTGACCGAAAAATACCGTGGTGCTCCTGTGACGCATTATCTCAATGAGCAGGCCAACCAGACCGAGCCGGATTGA




List of Contributions

There has not been any contribution yet.




Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox