PRGAV00000033 (Avr4)

From PRG Wiki
Jump to: navigation, search


Avr4
Gene Type Avirulence Genes
GenBank 1563716 (Y08356)
Gene Species Passalora fulva

Comment?

Description

C.fulvum avr4 gene

Sequence

TGCAGGCATGCTTACCTGTACCACTAAGCCAAGCGGGCGATACTGCAACGCAGATGAGTCAGCAAGGCGTAGATACAATATGTAGCTACGCAAAAGCGGTGAGAAAAGAGGCCACAAAAATGGACTGATGTGGCGAGCTGGACTTGGGCCGGCAATACAGAACTTCTGCTCCGTAACATGCTTACACCATTGCAAGTTTGCGACTACAGGATTACATTCTGCTCTGTATGCCAAGTGCTGTAGCATGTTCTACGCATTTGGGTTCTATCGTTGTCGTTACCAACGATTGGGCTCTACAAAATCTCGACTATGGACCAAGTCTTGGCATTTCACGAGAGCTTGGTACATGCGGAGAAAAAGACCCACGTGCCACCTAACCGACTTCACAGCTCACAACTTACACTGCATTGCAACAACATCTTGCCATCATACTTGATCTTTGCTATCTACGGAACCTACCACTTCCCCGAACCCTCGCTAGCCGACCGAGCCCTATTATCTGCCGCCTATTTGAACGAACTTTAATATACATTGCGCCTCGAAAGCCTCTAGCATCTATCTTTTTCGCGTACTCGAGCCGGCAACGAGTAGGAGAGGGGCCCTTACGAGGCAGGGGTATGCTCCCCGCCGATATGCCCTCCCCGAGGCTCAACGGCAACGTGCAGGATAGTCGACATTTAATGCACTTTAATTAGGATTTAACAAGGCAACTAGGGACCGGTCGGCTAGCTAGGGATCGGGGAAGTGTCGAGGTTCTACGGAATGGCACAGCTTCAATGCGTAGTGGCCAATTCCAATTTCTATGACCTAGACCAACAGCAGTACTATGACCATGAACCCGGCACGGCGACCACGGTAGGTCTGTACACGAGCCACAATAAGGCATGCTTTTTACAGGTTGCAAGGGAAAACGAAATTGGACATACGCAGGTCCAAAATAGCTCAGGAAGAGATTCAGGACATAATTTAAGCAGATCGCGACCTTCGACACGATCCCAAATCGCACTACTCAACGATCACACGACCTAGCGACTACAAGCACTCAAGGCATCCACAGCGATGCACTACACAACCCTCCTCCTAAGCACTCTCCTAGTCGGCACAGCCCTCGCCCAACCCACAAATCCTCCTGCGAAGACTCCCAAGAAGGCCCCCAAAACTCAACCATACAACCCATGCAAGCCCCAAGAAGTCATCGACACCAAGTGTATGGGTCCCAAGGATTGTCTCTACCCGAACCCCGACAGTTGTACAACCTACATACAGTGTGTACCGCTCGACGAAGTTGGCAATGCGAAGCCTGTGGTTAAGCCATGTCCAAAAGGACTGCAGTGGAACGATAACGTTGGCAAGAAGTGGTGCGACTATCCAAACCTGAGTACGTGTCCGGTAAAGACGCCGCAACCGAAGCCGAAGAAGGGAGGTGTCGGAGGGAAGAAGGCGTCGGTTGGACATCCTGGCTATTGAGTCGGACAAGAAAGGGGATAACGCAGTGTAAGGGACGTGGATAGATGGACGATGGGGCTGCTCTGACATCTATGTCTATTGTTTATACAACACATGAATTATGTACAATTAGTAAGGACCAGCAAGGTGAAATAACTGCGAACAAGATAGCGCTCAGCCGATATGCGGTACATTCCATGACCCAGTTCGTTGCGAGATGCTCCTGGCTGCATATACAACAGACGTCGAACCATTTCCGCTGTCAGCGCGAACCTAGCCAAGAAATACAGCATCGCTGTACACCAGAAGCACGAAGTCGACAAACTATGACCTCCAGATCGACGCAGGGTAAGGTAAAACGGCAGGAGGATTGGTCCGGCGACTGTCCTGTGATGCTCGCTATACGCCAGACCCAGAGATCGATAGTCGTTGGAAAGTACCAGTCCCAAGCCAGCAGATGCATGACTCCGATAGGACACTGGCCAAGATGAATAGGACGAGCCCACAGCGTCTTCTCTTCCTCAGTTCCGGACTTCCAGAAGTTTCCTGGC




List of Contributions

There has not been any contribution yet.




Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox