PRGAV00000035 (Avr9)

From PRG Wiki
Jump to: navigation, search


Avr9
Gene Type Avirulence Genes
GenBank 511970 (A19194)
Gene Species Passalora fulva

Comment?

Description

avr9

Sequence

AACACTACGAATTTCGAAAAATCCTCAAGCCTACTAAGGTCTTTGTAGCCATAGTCATTTTAATAAGTCTATCGACTTACGTATCTATCATGAAGCTTTCCCTCCTTAGCGTAGAGCTTGCTCTCCTAATTGCTACTACTCTCCCACTTTGCTGGGCAGCTGCCCTCCCTGTAGGATTGGGAGTCGGGCTAGACTACTGTAACTCAAGTTGTACTAGGGCCTTCGACTGTTTGGGTCAATGTGGCAGATGCGACTTTCATAAGCTACAATGTGTCCACTAGAGGACTAGAGAGGAAGTGGAGAGAAGAGGAGGGGAGAGGTACGATAACTAGCGAGTAAATCGTACAGGTAGAAAGGGATAGTAAGCAGGCAGATAGACGGACGACGTTGCGACCTTATCCAACATAAGTCCTAGTCGTAACATTCGTTCATATTGAAGGCTTTTCCTCAATAGTTTCTCAAATGTGCTGCGAGGCGCAGAGCCAAG




List of Contributions

There has not been any contribution yet.




Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox