PRGAV00000036 (AvrPto)

From PRG Wiki
Jump to: navigation, search


AvrPto
Gene Type Avirulence Genes
GenBank 309852 (L20425)
Gene Species Pseudomonas syringae

Comment?

Description

Pseudomonas syringae tomato avirulence protein (avrP) gene, complete cds

Sequence

GTCGACGGATCTGAACCTGGTGGTCGGCCAGAAGCACAATGCCACGGTGGGTGGCGACATGGTGGAGAGGATTCAGGGGCTGCGTGAGAGCATCACCAGTAAAAGCCAGCGTTTTCAGGCTCCTAAAAACTGGGTTGGGTCCAGCACTGTGAACATCTTTCAGGTGGTGTGCGACTTGCTGGATCTGGTCCAGGAAATGAATACCCAGCTTGCCGCGCACCAGCATGGGCCATCCCCGATACCGAGTAACGCAGCTGCGTTTACGGCGGACGCAGCCAAGGCAGCGTTACTGTGCGCCAAACTCAAGTCAGTGACGCTTTGATGTCTAAACCCGGCGCCAGCAAAATTTTGGGGAATTATCTTATAAGCTTGGAACCGATCCGCTCCCTATGACCACTCAAGTGGCGTCATAAATGCTGTACTAAAGAGGGTATACGAATGGGAAATATATGTGTCGGCGGATCCAGGATGGCCCATCAGGTGAACTCCCCAGACCGAGTTAGTAACAACTCGGGTGACGAAGATAACGTAACGTCCAGTCAACTGCTGAGCGTCAGACATCAACTTGCGGAGTCTGCTGGTCTACCAAGAGATCAGCATGAATTTGTTAGTAGCCAAGCACCTCAAAGCCTGAGAAATCGCTACAACAATCTTTACTCACATACGCAAAGAACACTGGATATGGCGGACATGCAGCATAGGTACATGACGGGAGCGTCAGGAATCAATCCGGGAATGCTGCCACATGAGAATGTGGACGATATGCGTAGCGCTATAACTGATTGGAGTGACATGCGCGAAGCTCTGCAGCACGCAATGGGTATCCATGCCGACATCCCACCGTCTCCAGAGCGATTTGTTGCGACTATGAACCCGAGCGGATCAATTCGAATGTCAACACTTTCTCCTAGCCCGTACCGTAACTGGCAATGATGTCAAGCCGTGTGTGGCGTCATAATGTCGACGCACACGGCCTGCATCTGTGATGCAATCCGTTGTGATCGCCTGATCTAAAATTCTACGTATTTACAGGTGAGTGCAGAGGTTCTTCAGTGCGTCACAACGGTCGATAGACAAAACTAAAGAGCAGTTAATTATAAGATGTGTCTCTAGA




List of Contributions

There has not been any contribution yet.




Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox