PRGAV00000037 (AvrPtoB)

From PRG Wiki
Jump to: navigation, search


AvrPtoB
Gene Type Avirulence Genes
GenBank 74231214 (DQ133533)
Gene Species Pseudomonas syringae pv. tomato

Comment?

Description

Pseudomonas syringae pv. tomato strain T1 avirulence protein AvrPtoB (avrPtoB) gene, complete cds

Sequence

AAAGGTGTGATGGAACTCTTTCCTGCTCTTTTTCCACACAGAGCTGATCTTGCGTGTGATTCGGTCCGCAGGCAGAAGATCGGAGAGGATCAGCATATGGCGGGTATCAATGGAGCGGGACCATCGGGCGCTTATTTTGTTGGCCACACAGACCCCGAGCCAGCATCGGGGGGCGCACACGGATCCAGCAGTGGCGCGAGATCCTCGAACAGTCCGCGCTTGCCGGCGCCTCCGGATGCACCCGCGTCGCAGGCGCGAGATCGACGCGAAATGCTTTTGCGAGCCAGGCCGCTGTCGCGCCAAACCAGGGAGTGGGTGGCGCAGGGTATGCCGCCAACGGCGGAGGCTGGAGTGCCCATCAGGCCGCAGGAGTCTGCCGAGGCTGCAGCGCCGCAGGCACGTGCAGAGGAAAGACACACGCCGGAGGCTGATGCAGCAGCGTCGCATGTACGCACAGAGGGAGGACGCACACCGCAGGCGCTTGCCGGTACCTCCCCACGCCACACAGGTGCGGTGCCACACGCCAATAGAATTGTTCAACAATTGGTTGACGCGGGCGCTGATCTTGCCGGTATTAACACCATGATTGACAATGCCATGCGTCGCCACGCGATAGCTCTTCCTTCTCGAACAGTACAGAGTATTTTGATCGAGCATTTCCCTCACCTGCTAGCGGGTGAACTCATTAGTGGCTCAGAGCTCGCTACCGCGTTCCGTGCGGCTCTCCGTCGGGAGGTTCGCCAACAGGAGGCGTCAGCCCCCCCAAGAACAGCAGCGCGGTCCTCCGTAAGGACGCCGGAGCGGTCGACGGTGCCGCCCACTTCTACGGAATCATCATCGGGCAGCAACCAGCGTACGTTATTAGGGCGGTTCGCCGGGTTGATGACGCCTAATCAGAGACGTCCGTCGAGCGCTTCGAACGCGTCTGCCTCTCAAAGGCCTGTAGACAGAAGCCCGCCACGCGTAAACCAGGTACCCACAGGCGCTAACAGGGTTGTGATGCGTAATCATGGTAATAACGAGGCCGACGCCGCGCTGCAAGGATTGGCTCAGCAGGGGGTTGATATGGAGGACCTGCGCGCCGCGCTTGAAAGACATATATTGCATCGCCGCCCGATCCCCATGGATATAGCGTACGCCTTGCAGGGTGTGGGCATTGCGCCAAGTATCGATACGGGAGAGAGCCTTATGGAAAACCCGCTGATGAATTTGAGTGTTGCGCTGCACCGCGCACTAGGGCCTCGTCCCGCTCGTGCTCAAGCGCCTCGTCCAGCCGTTCCGGTGGCTCCCGCGACCGTCTCCAGGCGACCAGATAGCGCGCGTGCCACAAGATTGCAGGTAATACCGGCGCGGGAGGATTACGAAAATAATGTGGCCTACGGAGTGCGCTTGCTGAGCCTGAATCCGGGCGCGGGGGTCAGGGAGACTGTTGCGGCCTTTGTAAACAACCGTTACGAGCGGCAGGCGGTTGTTGCCGACATACGCGCAGCCCTAAATTTATCTAAACAATTCAATAAGTTGCGTACGGTCTCTAAGGCCGATGCTGCCTCCAATAAACCGGGCTTCAAGGATGCGGCGGACCACCCAGACGACGCGACGCAATGCCTTTTTGGTGAAGAATTGTCGCTGACCAGTTCGGATCAGCAGGTGATCGGCCTGGCAGGTAAGGCAACGGACATGTCGGAGTCTTACAGCCGAGAGGCAAATAAGGACCTGGTGTTCATGGATATGAAAAAACTTGCCCAATTCCTCGCAGGCAAGCCTGAGCATCCGATGACCAGAGAAACGCTTAACGCCGAAAATATCGCCAAGTATGCTTTTAGAATAGTCCCCTGACCGCGCTGACAGCTAAAAGCC




List of Contributions

There has not been any contribution yet.




Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox