PRGAV00000038 (Avr3a)

From PRG Wiki
Jump to: navigation, search


Avr3a
Gene Type Avirulence Genes
GenBank 63086923 (AJ893356)
Gene Species Phytophthora infestans

Comment?

Description

Phytophthora infestans, clone PI-BAC-35J4

Sequence

ATGCGTCTGGCAATTATGCTGTCTGCTACGGCTGTCGCCATAAACTTTGCAACCAGCAGTGCAATCGACCAAACCAAGGTCCTGGTGTATGGGACGCCAGCTCACTACATACACGATTCAGCCGGCAGAAGACTTCTTCGCAAGAACGAAGAGAATGAAGAAACGTCTGAGGAGCGAGCCCCAAATTTCAATTTGGCGAATCTAAATGAGGAGATGTTTAATGTGGCTGCGTTGACGGAGAGAGCAGATGCCAAAAAGCTAGCGAAACAGCTTATGGGTAATGATAAGCTGGCGGATGCTGCATACATGTGGTGGCAGCACAACAGGGTTACGCTAGACCAGATTGACACGTTCCTGAAGCTTGCAAGCCGCAAGACGCAAGGCGCAAAGTACAATCAGATCTACAATAGCTACATGATGCACCTGGGGCTCACTGGATATTAG




List of Contributions

There has not been any contribution yet.




Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox