PRGAV00000039 (CP)

From PRG Wiki
Jump to: navigation, search


CP
Gene Type Avirulence Genes
GenBank 22671712 (AF535157)
Gene Species Potato virus X

Comment?

Description

Potato virus X 8 kDa protein and coat protein (CP) genes, complete cds

Sequence

ATGGAAGCAAATACATATCTCAACGCAATCATACTTGTGCTTGTGGTAACAATCATAGCAGTCATTAGTACTTCCTTAGTGAGGACTGAACCTTGTGTCATCAAGATTACTGGAGAATCAATCACAGTGTTGGCTTGCAAATTAGATGCAGAAACCATCAGAGCCATCGCCGATCTCAAGCCACTCTCCGTTGAACGGTTAAGTTTCCATTGATACTCGAAAGATGTCAGCACCAGCTAGCACAACACAGGCCACAGGGTCAACTACCTCAACTACCGCAAAAACTGCAGGCGCAACTCCTGCCACAGCTTCAGGACTGTTCACCATCCCGGATGGGGATTTCTTTAGTACAGCCCGCGCTATAGTAGCCAGCAATGCCGTTGCAACAAATGAGGACCTCAGCAAGATTGAGGCTATCTGGAAGGACATGAAGGTGCCCACAGACACTATGGCACAGGCTGCCTGGGACTTAGTCAGACACTGCGCTGACGTGGGCTCATCTGCTCAAACAGAAATGATAGATACAGGTCCCTATTCCAACGGCATCAGCAGAGCCAGACTGGCAGCAGCAATTAAAGAGGTGTGCATACTTAGGCAATTTTGCATGAAGTATGCCCCAGTGGTATGGAACTGGATGCTGACTAACAACAGTCCACCTGCTAACTGGCAAGCACAAGGCTTCAAGCCTGAGCACAAATTCGCTGCATTCGACTTCTTCAATGGAGTCACCAACCCAGCTGCCATCATGCCCAAAGAGGGGCTCATCCGGCCACCGTCTGAAGCTGAAATGAATGCTGCCCAAACTGCTGCCTTTGTGAAGATTACGAAGGCCAGGGCACAATCCAACGACTTTGCCAGCCTAGATGCAGCTGTCACTCGAGGTCGTATCACTGGAACAACAACCGCTGAGGCTGTTGTCACTCTCCCACCACCATAA




List of Contributions

There has not been any contribution yet.




Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox