PRGDB00046827 (disease resistance protein)

From PRG Wiki
Jump to: navigation, search
disease resistance protein
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 77696310 (DQ220596)
Gene Class Unknown
Domain Type LRR
Gene Species Arabidopsis thaliana

Comment?

Arabidopsis thaliana ecotype UP-14 disease resistance protein (At5g49140) gene, partial cds.

DNA Sequence

GCTTGCATATCTCAAGACGATAGATTTGAGCTTCTCCAATAATTTAGTAGAAGTTCCGGATCTTTCAAAGGCAATAAGTCTCGAGACATTGTGTCTAGAAGGTTGCCAAAGTTTGGCGGAGCTTCCTTCCTCTGTCTTGAATCTTCATAGACTAAAATGGTTGAGGCTGACTATGTGTGAAAAGCTAGAAGTTATACCGCTTCACATCAATTTGGCATCTCTTGAGGTCCTTGACATGGAAGGATGCTTAAAATTGAAAAGTTTTCCAGATATTTCGAAGAACATCGAAAGAATCTTTATGAAAAACACAGGGATAGAAGAAATACCTCCATCAATTAGTCAATGGTCTCGCCTTGAATCCCTTGATATTAGTGGCTGCCTAAACCTCAAGATATTTTCACATGTCCCCAAGAGTGTAGTGTATATATACCTAACGGATAGCGGTATTGAAAGGCTTCCAGATTGTATCAAAGATCTCACTTGGCTACACTACTTATACGTCGATAATTGTAGAAAACTTGTGTCACTGCCAGAGCTTCCAAGTTCGATCAAGATTCTATCAGCAATAAATTGTGAATCACTTGAGAGAATATCTTCATCTTTCGACTGTCCAAATGCGAAAGTCGAGTTCAGCAAATCCATGAATTTCGATGGAGAAG


Protein sequences

Name Description Sequence
disease resistance protein disease resistance protein [Arabidopsis thaliana].

LAYLKTIDLSFSNNLVEVPDLSKAISLETLCLEGCQSLAELPSSVLNLHRLKWLRLTMCEKLEVIPLHINLASLEVLDMEGCLKLKSFPDISKNIERIFMKNTGIEEIPPSISQWSRLESLDISGCLNLKIFSHVPKSVVYIYLTDSGIERLPDCIKDLTWLHYLYVDNCRKLVSLPELPSSIKILSAINCESLERISSSFDCPNAKVEFSKSMNFDGE


Domains

Domain Start-End Description Sequence

superfamily: SSF52058
1-208 SSF52058,LRR

LAYLKTIDLSFSNNLVEVPDLSKAISLETLCLEGCQSLAELPSSVLNLHRLKWLRLTMCEKLEVIPLHINLASLEVLDMEGCLKLKSFPDISKNIERIFMKNTGIEEIPPSISQWSRLESLDISGCLNLKIFSHVPKSVVYIYLTDSGIERLPDCIKDLTWLHYLYVDNCRKLVSLPELPSSIKILSAINCESLERISSSFDCPNAKV

HMMPanther: PTHR11017:SF20
1-219 PTHR11017:SF20,SUBFAMILY NOT NAMED

LAYLKTIDLSFSNNLVEVPDLSKAISLETLCLEGCQSLAELPSSVLNLHRLKWLRLTMCEKLEVIPLHINLASLEVLDMEGCLKLKSFPDISKNIERIFMKNTGIEEIPPSISQWSRLESLDISGCLNLKIFSHVPKSVVYIYLTDSGIERLPDCIKDLTWLHYLYVDNCRKLVSLPELPSSIKILSAINCESLERISSSFDCPNAKVEFSKSMNFDGE

HMMPanther: PTHR11017
1-219 PTHR11017,LEUCINE-RICH REPEAT-CONTAINING PROTEIN

LAYLKTIDLSFSNNLVEVPDLSKAISLETLCLEGCQSLAELPSSVLNLHRLKWLRLTMCEKLEVIPLHINLASLEVLDMEGCLKLKSFPDISKNIERIFMKNTGIEEIPPSISQWSRLESLDISGCLNLKIFSHVPKSVVYIYLTDSGIERLPDCIKDLTWLHYLYVDNCRKLVSLPELPSSIKILSAINCESLERISSSFDCPNAKVEFSKSMNFDGE

Gene3D: G3DSA:3.80.10.10
2-205 G3DSA:3.80.10.10

AYLKTIDLSFSNNLVEVPDLSKAISLETLCLEGCQSLAELPSSVLNLHRLKWLRLTMCEKLEVIPLHINLASLEVLDMEGCLKLKSFPDISKNIERIFMKNTGIEEIPPSISQWSRLESLDISGCLNLKIFSHVPKSVVYIYLTDSGIERLPDCIKDLTWLHYLYVDNCRKLVSLPELPSSIKILSAINCESLERISSSFDCPN

HMMPfam: PF00560
IPR001611
73-92 LRR_1
Leucine-rich repeat

SLEVLDMEGCLKLKSFPDIS

HMMPfam: PF00560
IPR001611
117-133 LRR_1
Leucine-rich repeat

RLESLDISGCLNLKIFS

HMMPfam: PF13504
161-177 LRR_7,Leucine rich repeat

WLHYLYVDNCRKLVSLP


List of References



List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox