PRGDB00046933 (RPM1)

From PRG Wiki
Jump to: navigation, search
RPM1
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 5231064 (AF123026)
Gene Class Unknown
Domain Type
Gene Species Arabidopsis thaliana

Comment?

Arabidopsis thaliana cultivar WL2-2 disease resistance protein (RPM1) variant gene, partial cds. and 3' sequence.

DNA Sequence

AAGCATTATTTCAGAACTGATAATGGCTCTTTCTATGTGAGCCTCTCATCTTAG


Protein sequences

Name Description Sequence
disease resistance protein disease resistance protein [Arabidopsis thaliana].

KHYFRTDNGSFYVSLSS







List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox