PRGDB00047097 (putative disease resistance protein)

From PRG Wiki
Jump to: navigation, search
putative disease resistance protein
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 85541776 (DQ341406)
Gene Class NL
Domain Type NBS, LRR, Others
Gene Species Ipomoea batatas

Comment?

Ipomoea batatas clone SPRGA-12 putative disease resistance protein gene, partial cds.

DNA Sequence

GGGGGTGTTGGTAAGACTACCATTGCTAAAGCCATGTATGAAAAAATTAATGGAATGTTCGATGGTAATTGCTTTCTTGGAGATGTTAGATCAAAATGTTTAGAGAAAGGATGCGCAGGGTTAAAATGCTTACAGGAGCAGCTTCTTTGTAAAATTCTCCTCACAACAAAAGTTGAAGTTGACAATGTTGACGAAGGAATTAGTTTGATCGAAAGAAGACTTCGAGCTAAAAAGGTTCTTATTGTTATTGATGACATAGACAGTGAGATTCAATTAAATGCATTAGCTGGAGAGCGAAATTGGTTTGGTCGAGGAAGTACAATTATCGTTACGACTAGAAATGCTAATTTGTTGAATGGCCCTGGAAAAGATTATGAAAAGTATGAGGTCCGACGGTTAGACTTTGACAAATCGTTGCAACTCTTTAGTTGGCATACTTTTAAGCATCCTAACCCATTGGAGCCTTTTGTTGAAATATCAGACAAGATAGTAAGTTTTGCTGGGGGACTTCCTCTGGCGGC


Protein sequences

Name Description Sequence
putative disease resistance protein putative disease resistance protein [Ipomoea batatas].

GGVGKTTIAKAMYEKINGMFDGNCFLGDVRSKCLEKGCAGLKCLQEQLLCKILLTTKVEVDNVDEGISLIERRLRAKKVLIVIDDIDSEIQLNALAGERNWFGRGSTIIVTTRNANLLNGPGKDYEKYEVRRLDFDKSLQLFSWHTFKHPNPLEPFVEISDKIVSFAGGLPLAA

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR11017:SF20
1-173 PTHR11017:SF20,SUBFAMILY NOT NAMED

GGVGKTTIAKAMYEKINGMFDGNCFLGDVRSKCLEKGCAGLKCLQEQLLCKILLTTKVEVDNVDEGISLIERRLRAKKVLIVIDDIDSEIQLNALAGERNWFGRGSTIIVTTRNANLLNGPGKDYEKYEVRRLDFDKSLQLFSWHTFKHPNPLEPFVEISDKIVSFAGGLPLA

HMMPfam: PF00931
IPR002182
1-173 NB-ARC,NBS
NB-ARC

GGVGKTTIAKAMYEKINGMFDGNCFLGDVRSKCLEKGCAGLKCLQEQLLCKILLTTKVEVDNVDEGISLIERRLRAKKVLIVIDDIDSEIQLNALAGERNWFGRGSTIIVTTRNANLLNGPGKDYEKYEVRRLDFDKSLQLFSWHTFKHPNPLEPFVEISDKIVSFAGGLPLA

HMMPanther: PTHR11017
1-173 PTHR11017,LEUCINE-RICH REPEAT-CONTAINING PROTEIN

GGVGKTTIAKAMYEKINGMFDGNCFLGDVRSKCLEKGCAGLKCLQEQLLCKILLTTKVEVDNVDEGISLIERRLRAKKVLIVIDDIDSEIQLNALAGERNWFGRGSTIIVTTRNANLLNGPGKDYEKYEVRRLDFDKSLQLFSWHTFKHPNPLEPFVEISDKIVSFAGGLPLA

superfamily: SSF52540
1-173 SSF52540

GGVGKTTIAKAMYEKINGMFDGNCFLGDVRSKCLEKGCAGLKCLQEQLLCKILLTTKVEVDNVDEGISLIERRLRAKKVLIVIDDIDSEIQLNALAGERNWFGRGSTIIVTTRNANLLNGPGKDYEKYEVRRLDFDKSLQLFSWHTFKHPNPLEPFVEISDKIVSFAGGLPLA

Gene3D: G3DSA:3.40.50.300
2-126 G3DSA:3.40.50.300

GVGKTTIAKAMYEKINGMFDGNCFLGDVRSKCLEKGCAGLKCLQEQLLCKILLTTKVEVDNVDEGISLIERRLRAKKVLIVIDDIDSEIQLNALAGERNWFGRGSTIIVTTRNANLLNGPGKDYE

FPrintScan: PR00364
IPR000767
73-87 DISEASERSIST
Disease resistance protein

RLRAKKVLIVIDDID

FPrintScan: PR00364
IPR000767
167-174 DISEASERSIST
Disease resistance protein

AGGLPLAA


List of References

Guanshui Chen, Daren Pan, Yifei Zhou, Sheng Lin, Xiangde Ke
Diversity and evolutionary relationship of nucleotide binding site-encoding disease-resistance gene analogues in sweet potato (Ipomoea batatas Lam.).
J. Biosci.: 2007, 32(4);713-21
PubMed:17762144 WorldCat.org (P p)





List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox