PRGDB00047512 (T8L23.23)

From PRG Wiki
Jump to: navigation, search
T8L23.23
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 9994129 (AC079733)
Gene Class T
Domain Type TIR, LRR
Gene Species Arabidopsis thaliana

Comment?

Arabidopsis thaliana chromosome 1 BAC T8L23 genomic sequence, complete sequence.

DNA Sequence

ATCCGAGGCCAAATTTATCAAGAAGGTTCTGAAGGCGGTTGAGGAAGTTTTAACCACTATTCAATCTGATGAAGCAAAAGAAGGCAACTGTGTGGAGGATGTTGAAACATTTAACGTTCCACTGACTCTGCCTTGGTCATGGTTTAGCTCGGCGGTTGAGCTAATTGGTGCAATTCTCGGCTTACTCGCTGAGACTGTTCACGCTGATGAAGGAAGAAGAGAAGCTGATTTTGTGAAGAAAGTGAAAACACTTAATGTTCCACTGGCTTTGCCATGGTTATGGTTTGGCTCGGCGGTTGAACTAATTGGTGCAGTGGTCGGCTTACTCATTAAGGCTGTTCAATCTGATGAAAGAAAAGAAGATGGTTGCGTGAAGAAAGTGAAAACATTTAACATTGCACTGGCTCTGCCATGGTTATGGTTTGGTTCGGCGGTAGAGCTGATTGGTTCAGTGCTTGGCATCATTAACACTGTTCGTTCTGGTGAAGGAAGAGAAGATGATTGTGTGAAGAAAGTGAAAACATTTTACGTTCCACTGGCTCTGCCATGGTTATGGTTTGGCTCTGCGGTTGAGCTGGTTGGTGCAGTGCTCGGCTTACTAAATGAAATTGTTCACAAGTGTGCCTCACCAACCATGGTTATTCTTGCTAGTCAAGTTGGCTCTGTTGTGGCTATTTCGAGCCGTTGGGCTGATAAGTCTGTCTGAGTATGGGGAATCAAAATGGTGTTTGGAAGAACTGACGACAATCATGGACCAAGAAGAAAAAGGGCAAATGATTGTCATCCCAATCTTCTATAAAGTGAGAACGGAAGACGTGGAGAAACAAACGGGAGAGTTCGGCCATATGTTTTGGAGTTGCGATGAAGAAGCAAGTCTTGAAGAGATGGAGAAATGGCAAGTGGCTTTGAAGGCTGTGTGCAACAAAATTGGACTCACGTTGGATCTTAAAAGATGGCAATTCTATCTCGCCCCGTCAATCAAGTTTTCATCAACTTCCGGGGAAAGGATATTCGCCACGGCTTTGTCAGTCATCTTAAAGATGCCTTGAAAAGAAAAAATATCAACTTCTTCATCGATACACATGAACAAAAGGGAAGAGACCTGAACCACCTCTTTAAACGGATTGAAGAGGCCACGATCGCGCTGGTCATCTTATCCCCAAG


Protein sequences

Name Description Sequence
disease resistance protein RPS4, putative disease resistance protein RPS4, putative [Arabidopsis thaliana].

MAILSRPVNQVFINFRGKDIRHGFVSHLKDALKRKNINFFIDTHEQKGRDLNHLFKRIEEATIALVILSPRYGESKWCLEELTTIMDQEEKGQMIVIPIFYKVRTEDVEKQTGEFGHMFWSCDEEASLEEMEKWQVALKAVCNKIGLTLDLKRSEAKFIKKVLKAVEEVLTTIQSDEAKEGNCVEDVETFNVPLTLPWSWFSSAVELIGAILGLLAETVHADEGRREADFVKKVKTLNVPLALPWLWFGSAVELIGAVVGLLIKAVQSDERKEDGCVKKVKTFNIALALPWLWFGSAVELIGSVLGIINTVRSGEGREDDCVKKVKTFYVPLALPWLWFGSAVELVGAVLGLLNEIVHKCASPTMVILASQVGSVVAISSRWADKSV

Domains

Domain Start-End Description Sequence

ProfileScan: PS50104
IPR000157
7-144 TIR
Toll/interleukin-1 receptor homology (TIR) domain

PVNQVFINFRGKDIRHGFVSHLKDALKRKNINFFIDTHEQKGRDLNHLFKRIEEATIALVILSPRYGESKWCLEELTTIMDQEEKGQMIVIPIFYKVRTEDVEKQTGEFGHMFWSCDEEASLEEMEKWQVALKAVCNK

HMMSmart: SM00255
IPR000157
8-144 TIR
Toll/interleukin-1 receptor homology (TIR) domain

VNQVFINFRGKDIRHGFVSHLKDALKRKNINFFIDTHEQKGRDLNHLFKRIEEATIALVILSPRYGESKWCLEELTTIMDQEEKGQMIVIPIFYKVRTEDVEKQTGEFGHMFWSCDEEASLEEMEKWQVALKAVCNK

superfamily: SSF52200
IPR000157
10-147 TIR
Toll/interleukin-1 receptor homology (TIR) domain

QVFINFRGKDIRHGFVSHLKDALKRKNINFFIDTHEQKGRDLNHLFKRIEEATIALVILSPRYGESKWCLEELTTIMDQEEKGQMIVIPIFYKVRTEDVEKQTGEFGHMFWSCDEEASLEEMEKWQVALKAVCNKIGL

Gene3D: G3DSA:3.40.50.10140
10-143 G3DSA:3.40.50.10140

QVFINFRGKDIRHGFVSHLKDALKRKNINFFIDTHEQKGRDLNHLFKRIEEATIALVILSPRYGESKWCLEELTTIMDQEEKGQMIVIPIFYKVRTEDVEKQTGEFGHMFWSCDEEASLEEMEKWQVALKAVCN

HMMPfam: PF01582
IPR000157
11-139 TIR
Toll/interleukin-1 receptor homology (TIR) domain

VFINFRGKDIRHGFVSHLKDALKRKNINFFIDTHEQKGRDLNHLFKRIEEATIALVILSPRYGESKWCLEELTTIMDQEEKGQMIVIPIFYKVRTEDVEKQTGEFGHMFWSCDEEASLEEMEKWQVALK

HMMPanther: PTHR23155
18-164 PTHR23155,LRR,LEUCINE-RICH REPEAT-CONTAINING PROTEIN

KDIRHGFVSHLKDALKRKNINFFIDTHEQKGRDLNHLFKRIEEATIALVILSPRYGESKWCLEELTTIMDQEEKGQMIVIPIFYKVRTEDVEKQTGEFGHMFWSCDEEASLEEMEKWQVALKAVCNKIGLTLDLKRSEAKFIKKVLK

HMMPanther: PTHR23155:SF247
18-164 PTHR23155:SF247,SUBFAMILY NOT NAMED

KDIRHGFVSHLKDALKRKNINFFIDTHEQKGRDLNHLFKRIEEATIALVILSPRYGESKWCLEELTTIMDQEEKGQMIVIPIFYKVRTEDVEKQTGEFGHMFWSCDEEASLEEMEKWQVALKAVCNKIGLTLDLKRSEAKFIKKVLK






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox