PRGDB00048940 (NBS-LRR type disease resistance protein)

From PRG Wiki
Jump to: navigation, search
NBS-LRR type disease resistance protein
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 83031704 (DQ119306)
Gene Class NL
Domain Type NBS, LRR, Others
Gene Species Musa acuminata

Comment?

Musa acuminata NBS-LRR type disease resistance protein mRNA, complete cds.

DNA Sequence

ATGCATCACTCCCCCTTCACCACGAGCCGCACGGGAGCCGGTGGAGGAACTGCCGTTGAAACGCAGACCATCGGGATGGAGTTGGCCCTAAGCCAGCTCCTATCCCGGTTTGACGACACGGAGAAGAGCATCATCGGCGTCCACGGGCTAGGGGGCATGGGCAAGACGACGCTCCTCAAAACGCCCAACAACGAGCTCAAGGAGAATACCCGCGATTACCATGTGGTGATCATGATCGAGGTTGCCAACTCCGAGACGCTCAACGTCGTCGATATGCAGAAGATCATCGCCAATCGGCTGGGTCTGCCGTGGAACGAGAGCGAGACGGAGAGGGAGCGATCCACCTTTCTGCGCAGGGCCCTGAGGAGGAAGAAGTTCGTTGTCCTGCTCGACGACGTCTGGAAAAAGTTCCAGTTGGCGGACGTGGGAATCCCCACGCCAAGCTCCGACAACGGGTGTAAGCTGATCGTCGCCTCGCGGTCGAACCAGGTGTGCGTCGAGATGGGCGACAAGGAGCCCATGGAGATGCCCTGCTTGAACGAGAATGAATCACTGAGGTTGTTCCGGAGCAACTTGATGGCCGAGGTCAGTGCCGCCATCGACCATGACAGCGACATGAGAGAAAGCGCCATGGATATCATACAGAGCTGCGGCGGCCTTCCACTAGCACTCAACGTCGTAGGCTGCGCTCTCGCGTGCAGCATGGATGCGGTGGAATGGAAGCAAGCGGCAAGAGCAATGAGGGCGATACTCGTGGAGGATCAATCTCTAGAGG


Protein sequences

Name Description Sequence
NBS-LRR type disease resistance protein NBS-LRR type disease resistance protein [Musa acuminata].

MHHSPFTTSRTGAGGGTAVETQTIGMELALSQLLSRFDDTEKSIIGVHGLGGMGKTTLLKTPNNELKENTRDYHVVIMIEVANSETLNVVDMQKIIANRLGLPWNESETERERSTFLRRALRRKKFVVLLDDVWKKFQLADVGIPTPSSDNGCKLIVASRSNQVCVEMGDKEPMEMPCLNENESLRLFRSNLMAEVSAAIDHDSDMRESAMDIIQSCGGLPLALNVVGCALACSMDAVEWKQAARAMRAILVEDQSLE

Domains

Domain Start-End Description Sequence

superfamily: SSF52540
6-254 SSF52540

FTTSRTGAGGGTAVETQTIGMELALSQLLSRFDDTEKSIIGVHGLGGMGKTTLLKTPNNELKENTRDYHVVIMIEVANSETLNVVDMQKIIANRLGLPWNESETERERSTFLRRALRRKKFVVLLDDVWKKFQLADVGIPTPSSDNGCKLIVASRSNQVCVEMGDKEPMEMPCLNENESLRLFRSNLMAEVSAAIDHDSDMRESAMDIIQSCGGLPLALNVVGCALACSMDAVEWKQAARAMRAILVED

HMMPfam: PF00931
IPR002182
33-254 NB-ARC,NBS
NB-ARC

LLSRFDDTEKSIIGVHGLGGMGKTTLLKTPNNELKENTRDYHVVIMIEVANSETLNVVDMQKIIANRLGLPWNESETERERSTFLRRALRRKKFVVLLDDVWKKFQLADVGIPTPSSDNGCKLIVASRSNQVCVEMGDKEPMEMPCLNENESLRLFRSNLMAEVSAAIDHDSDMRESAMDIIQSCGGLPLALNVVGCALACSMDAVEWKQAARAMRAILVED

Gene3D: G3DSA:3.40.50.300
38-134 G3DSA:3.40.50.300

DDTEKSIIGVHGLGGMGKTTLLKTPNNELKENTRDYHVVIMIEVANSETLNVVDMQKIIANRLGLPWNESETERERSTFLRRALRRKKFVVLLDDVW

FPrintScan: PR00364
IPR000767
44-59 DISEASERSIST
Disease resistance protein

IIGVHGLGGMGKTTLL

HMMPanther: PTHR23155
44-214 PTHR23155,LRR,LEUCINE-RICH REPEAT-CONTAINING PROTEIN

IIGVHGLGGMGKTTLLKTPNNELKENTRDYHVVIMIEVANSETLNVVDMQKIIANRLGLPWNESETERERSTFLRRALRRKKFVVLLDDVWKKFQLADVGIPTPSSDNGCKLIVASRSNQVCVEMGDKEPMEMPCLNENESLRLFRSNLMAEVSAAIDHDSDMRESAMDII

HMMPanther: PTHR23155:SF119
44-214 PTHR23155:SF119,RFL1 (RPS5-LIKE 1)

IIGVHGLGGMGKTTLLKTPNNELKENTRDYHVVIMIEVANSETLNVVDMQKIIANRLGLPWNESETERERSTFLRRALRRKKFVVLLDDVWKKFQLADVGIPTPSSDNGCKLIVASRSNQVCVEMGDKEPMEMPCLNENESLRLFRSNLMAEVSAAIDHDSDMRESAMDII

FPrintScan: PR00364
IPR000767
120-134 DISEASERSIST
Disease resistance protein

ALRRKKFVVLLDDVW

FPrintScan: PR00364
IPR000767
217-231 DISEASERSIST
Disease resistance protein

CGGLPLALNVVGCAL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox