PRGDB00049559 (disease resistance protein-related)

From PRG Wiki
Jump to: navigation, search
disease resistance protein-related
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 42568330 (NM_123917)
Gene Class N
Domain Type NBS
Gene Species Arabidopsis thaliana

Comment?

Arabidopsis thaliana disease resistance protein-related (AT5G45490) mRNA, complete cds.

DNA Sequence

ATGCCTTCAAAAAATCTACAACAGGCAGTCCTCACAAACGAATTCACAACCAACTTCATTACGACCTGTAAGGACTGGCTCGACGTAAATGGTCTTGCTAAAGGAAACTTGGAGAAGAAGAGAGATGATAATGAAGAAGAAGAGCGTCTGAAAACCGAGTCTAAACTTCCGGGCCATGACATCCACGGTTTCGATAACGAGATCAAGTCATTGCAACACTTCTTGTTGGATCAGAAGGTTAGGAGGGAGTTCAAGAGTCTTGTGATTGTCGGAGAATATGGTGTTGGGAAGACAGCATTATGCCAGAAGATCTTCAATGATGAAGCTGTGAAGAGTGTTTATGCTCCCAGGGTTTGGGTGTCTATGGAAAACAAAGAATCTAAGGAGGGACTTGATGGGAAGATATGTGTGTTGAAGAAGATCTTGAAGGGTCTTGGAGTTGAAGAGTTAATCCTCGAAACTATCAGTACTGATGCCAAACAAGAATTTAAGGACAATGAGGAAGTTGCAAGCAATCAGGAAGCTGGAGAAATTGATAGAGAGACGGAGAAAGAGAAGGAGCTCTCTGCTCTGCTCTATGCACTTCACTTGAATCTGAGGTGGAAGAAATATCTGATTGTGTTTGATGATGTTCGGGAAAACGATAACTGGGACGAAAAGCTTGATGCGAAACTCAAGGAGGATGAGAAATGGGGAAAGTATCTTTCAGATGGATTCCCTAAAGGGTCTGGTGGGAGAGTCATATACACGACCAGAGATGAGAATCTGGCGAAGAACCTTGTTGCTCAGAAACATGAGATCCATCGTCTTTGGCCGCTGTCTGATCATCAGAGTGTCTGGAAGATATATGATGCAGTGGTTAAAGATAAACAGAAAGAGTCACCAAGGAACGACAAGAAATGTATAGATGAGCTGATGAATAAGTCTCGTGGTCTTCCTCTGGCTGCCAGACTGTTGGCTGAGCGTGATCCCGTCTTTGTTGACGATGAAGTTGGCCCTGTTGGTTCTACCCATGGACAAACCGACTCATCGAACCGCCAACCTGCAAACCAGGCCAGCTCCTGA


Protein sequences

Name Description Sequence
disease resistance protein-related disease resistance protein-related [Arabidopsis thaliana].

MPSKNLQQAVLTNEFTTNFITTCKDWLDVNGLAKGNLEKKRDDNEEEERLKTESKLPGHDIHGFDNEIKSLQHFLLDQKVRREFKSLVIVGEYGVGKTALCQKIFNDEAVKSVYAPRVWVSMENKESKEGLDGKICVLKKILKGLGVEELILETISTDAKQEFKDNEEVASNQEAGEIDRETEKEKELSALLYALHLNLRWKKYLIVFDDVRENDNWDEKLDAKLKEDEKWGKYLSDGFPKGSGGRVIYTTRDENLAKNLVAQKHEIHRLWPLSDHQSVWKIYDAVVKDKQKESPRNDKKCIDELMNKSRGLPLAARLLAERDPVFVDDEVGPVGSTHGQTDSSNRQPANQASS


Domains

Domain Start-End Description Sequence

superfamily: SSF52540
43-321 SSF52540

DNEEEERLKTESKLPGHDIHGFDNEIKSLQHFLLDQKVRREFKSLVIVGEYGVGKTALCQKIFNDEAVKSVYAPRVWVSMENKESKEGLDGKICVLKKILKGLGVEELILETISTDAKQEFKDNEEVASNQEAGEIDRETEKEKELSALLYALHLNLRWKKYLIVFDDVRENDNWDEKLDAKLKEDEKWGKYLSDGFPKGSGGRVIYTTRDENLAKNLVAQKHEIHRLWPLSDHQSVWKIYDAVVKDKQKESPRNDKKCIDELMNKSRGLPLAARLLAE

Gene3D: G3DSA:3.40.50.300
55-223 G3DSA:3.40.50.300

KLPGHDIHGFDNEIKSLQHFLLDQKVRREFKSLVIVGEYGVGKTALCQKIFNDEAVKSVYAPRVWVSMENKESKEGLDGKICVLKKILKGLGVEELILETISTDAKQEFKDNEEVASNQEAGEIDRETEKEKELSALLYALHLNLRWKKYLIVFDDVRENDNWDEKLDA

HMMPfam: PF00931
IPR002182
65-321 NB-ARC,NBS
NB-ARC

DNEIKSLQHFLLDQKVRREFKSLVIVGEYGVGKTALCQKIFNDEAVKSVYAPRVWVSMENKESKEGLDGKICVLKKILKGLGVEELILETISTDAKQEFKDNEEVASNQEAGEIDRETEKEKELSALLYALHLNLRWKKYLIVFDDVRENDNWDEKLDAKLKEDEKWGKYLSDGFPKGSGGRVIYTTRDENLAKNLVAQKHEIHRLWPLSDHQSVWKIYDAVVKDKQKESPRNDKKCIDELMNKSRGLPLAARLLAE






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox