PRGDB00049563 (Hm2)

From PRG Wiki
Jump to: navigation, search
Hm2
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 166429527 (NM_001114161)
Gene Class Unknown
Domain Type
Gene Species Zea mays

Comment?

Zea mays NADPH HC toxin reductase-like protein (Hm2), mRNA.

DNA Sequence

ATGGGTGGCGGCACGGTGGTGTGTGTCACCGGCGGCAGCGGCTACCTCGGGAGCTGGCTCGTCAGGAAGCTCCTCGGCAGAGGCTGCGTCGTCCACGCCACCCTGCGGAGCCTCGCGGACGAGAAGAAGACGGGGCTGCTCCGGGCGCTCCCCGGCGCGGCGGAGCGGCTGCGGCTGTTCGAGGCGGACATGTACGACGCCGACACCTTCGAGCCCGCCATCGCCGGCTGCCACTTCGTCTTCCTCGTCGCCACGCCCCTGACGCACGACCCCACCAGCACCAAGTACAAGAACACGACGGAGGCGGCGGTGGACGCGGCGCGCATCATCCTCCGGCAGTGCGCGCTGTCCGGCACGGTGAAGCGCGTCATCCACACGGCCTCGGTCACGGCCGCGTCGCCGCTCAAGGAGGACGGCAGCGGGTACAAGGACTTCGCCGACGAGTCCAATTGGACGCCGCTCAACCTCTCCTGCGAATTCAGCAACGCTTACCTGGACGACTACGTGCGGTCCAAGACGCTGTCGGAGAAGGAGCTACTGAGCTACTCCTCCTCCTCCTCCTCCAAGGAAGACGACCGGACCCGGGCGTTGGAGGTGGTCACCCTAACGTGCGGGCTCGTCGGCGGCGACAGCATCCAGACGTACCTGTGGGGCAACATCGCCGCGATTCTGGCGCCGCTGACGGGGCAAGCGGTCAATCACAACGCCCTCCTCTTCTTGCAAGCGCTGCTGGGCTCCGTGCCGCTGGTGCACGTTGAGGACGTCTGCCAGGCACACGTCTTCTGCATGGAGCAGGAGTCCATGACCGGCCGCTTCCTCTGCGCCGCCGGGTACCCCAACATGCGTGACATCGTCGACCACTTTGCCGCAAAGCAACCCCGACCTCAAGATACAGCTGACTCAAGTGACCGGAGAAGGGGTCAGGATTCAGCCCAACACCAGCAAGCTGGAGGACTTGGGGTTCAGATTCAAGTATGGAGTGGAGGAGACGCTGGACTGCAGCGTCGAGTGCGCCAAGAGGCTGGGAGAGCTCTAGATGCATGCTACGCATGCATGCGCAGCATTGGGATTCAGCGACTGTGA


Protein sequences

Name Description Sequence
NADPH HC toxin reductase-like protein NADPH HC toxin reductase-like protein [Zea mays].

MGGGTVVCVTGGSGYLGSWLVRKLLGRGCVVHATLRSLADEKKTGLLRALPGAAERLRLFEADMYDADTFEPAIAGCHFVFLVATPLTHDPTSTKYKNTTEAAVDAARIILRQCALSGTVKRVIHTASVTAASPLKEDGSGYKDFADESNWTPLNLSCEFSNAYLDDYVRSKTLSEKELLSYSSSSSSKEDDRTRALEVVTLTCGLVGGDSIQTYLWGNIAAILAPLTGQAVNHNALLFLQALLGSVPLVHVEDVCQAHVFCMEQESMTGRFLCAAGYPNMRDIVDHFAAKQPRPQDTADSSDRRRGQDSAQHQQAGGLGVQIQVWSGGDAGLQRRVRQEAGRALDACYACMRSIGIQRL

Domains

Domain Start-End Description Sequence

superfamily: SSF51735
4-302 NAD(P)-bd

GTVVCVTGGSGYLGSWLVRKLLGRGCVVHATLRSLADEKKTGLLRALPGAAERLRLFEADMYDADTFEPAIAGCHFVFLVATPLTHDPTSTKYKNTTEAAVDAARIILRQCALSGTVKRVIHTASVTAASPLKEDGSGYKDFADESNWTPLNLSCEFSNAYLDDYVRSKTLSEKELLSYSSSSSSKEDDRTRALEVVTLTCGLVGGDSIQTYLWGNIAAILAPLTGQAVNHNALLFLQALLGSVPLVHVEDVCQAHVFCMEQESMTGRFLCAAGYPNMRDIVDHFAAKQPRPQDTADSS

Gene3D: G3DSA:3.40.50.720
IPR016040
5-293 NAD(P)-bd
NAD(P)-binding domain

TVVCVTGGSGYLGSWLVRKLLGRGCVVHATLRSLADEKKTGLLRALPGAAERLRLFEADMYDADTFEPAIAGCHFVFLVATPLTHDPTSTKYKNTTEAAVDAARIILRQCALSGTVKRVIHTASVTAASPLKEDGSGYKDFADESNWTPLNLSCEFSNAYLDDYVRSKTLSEKELLSYSSSSSSKEDDRTRALEVVTLTCGLVGGDSIQTYLWGNIAAILAPLTGQAVNHNALLFLQALLGSVPLVHVEDVCQAHVFCMEQESMTGRFLCAAGYPNMRDIVDHFAAKQP

HMMPanther: PTHR10366
7-293 PTHR10366,NAD DEPENDENT EPIMERASE/DEHYDRATASE

VCVTGGSGYLGSWLVRKLLGRGCVVHATLRSLADEKKTGLLRALPGAAERLRLFEADMYDADTFEPAIAGCHFVFLVATPLTHDPTSTKYKNTTEAAVDAARIILRQCALSGTVKRVIHTASVTAASPLKEDGSGYKDFADESNWTPLNLSCEFSNAYLDDYVRSKTLSEKELLSYSSSSSSKEDDRTRALEVVTLTCGLVGGDSIQTYLWGNIAAILAPLTGQAVNHNALLFLQALLGSVPLVHVEDVCQAHVFCMEQESMTGRFLCAAGYPNMRDIVDHFAAKQP

HMMPfam: PF01370
IPR001509
7-270 Epimerase
NAD-dependent epimerase/dehydratase

VCVTGGSGYLGSWLVRKLLGRGCVVHATLRSLADEKKTGLLRALPGAAERLRLFEADMYDADTFEPAIAGCHFVFLVATPLTHDPTSTKYKNTTEAAVDAARIILRQCALSGTVKRVIHTASVTAASPLKEDGSGYKDFADESNWTPLNLSCEFSNAYLDDYVRSKTLSEKELLSYSSSSSSKEDDRTRALEVVTLTCGLVGGDSIQTYLWGNIAAILAPLTGQAVNHNALLFLQALLGSVPLVHVEDVCQAHVFCMEQESMTG

HMMPanther: PTHR10366:SF81
7-293 PTHR10366:SF81,OS07G0601100 PROTEIN

VCVTGGSGYLGSWLVRKLLGRGCVVHATLRSLADEKKTGLLRALPGAAERLRLFEADMYDADTFEPAIAGCHFVFLVATPLTHDPTSTKYKNTTEAAVDAARIILRQCALSGTVKRVIHTASVTAASPLKEDGSGYKDFADESNWTPLNLSCEFSNAYLDDYVRSKTLSEKELLSYSSSSSSKEDDRTRALEVVTLTCGLVGGDSIQTYLWGNIAAILAPLTGQAVNHNALLFLQALLGSVPLVHVEDVCQAHVFCMEQESMTGRFLCAAGYPNMRDIVDHFAAKQP


List of References

Anoop Sindhu, Satya Chintamanani, Amanda S Brandt, Michael Zanis, Steven R Scofield, Gurmukh S Johal
A guardian of grasses: specific origin and conservation of a unique disease-resistance gene in the grass lineage.
Proc. Natl. Acad. Sci. U.S.A.: 2008, 105(5);1762-7
PubMed:18230731 WorldCat.org DOI (I p)

Satya Chintamanani, Dilbag S Multani, Holly Ruess, Gurmukh S Johal
Distinct mechanisms govern the dosage-dependent and developmentally regulated resistance conferred by the maize Hm2 gene.
Mol. Plant Microbe Interact.: 2008, 21(1);79-86
PubMed:18052885 WorldCat.org DOI (P p)

Jack Gardiner, Steven Schroeder, Mary L Polacco, Hector Sanchez-Villeda, Zhiwei Fang, Michele Morgante, Tim Landewe, Kevin Fengler, Francisco Useche, Michael Hanafey, Scott Tingey, Hugh Chou, Rod Wing, Carol Soderlund, Edward H Coe
Anchoring 9,371 maize expressed sequence tagged unigenes to the bacterial artificial chromosome contig map by two-dimensional overgo hybridization.
Plant Physiol.: 2004, 134(4);1317-26
PubMed:15020742 WorldCat.org DOI (P p)





List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox