PRGDB00049663 (HcrSC9-0B)

From PRG Wiki
Jump to: navigation, search
HcrSC9-0B
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 4235645 (AF119041)
Gene Class Unknown
Domain Type
Gene Species Solanum lycopersicum

Comment?

Lycopersicon esculentum haplotype Southern Cross lipoxygenase gene, partial cds; and Hcr9 gene cluster, complete sequence.

DNA Sequence

GCTAAGAACTCATTGTTGTACAGAGCCATACATTATAGCATCTAATAGGCAACTAAGTGCAATGCATCCAATATATAGATTATTATTTCCTCATTTTAGATATACAATGGAGATAAATGGTACAGCTAGAGAAGCACTTATTAATGCAAATGGTGTTATTGAGAGTTCATTTTCCCCTGGCAAGTATTCAATGGAGTTGAGTTCTGTTGCCTATGATCTTCACTGGAGGTTTGATAGAGAAGCACTCCCTGAGGACCTTATTAGTAGGGGATTGGCAGAGGAAAATCCAAATGCACCATATGTATTGAGACTAACAATAGAAGATTATCCTTCTGCTAGTGATGGTTTAGTTTGGGACATACTTAAACAATGGGTAACAAATTATGTCAACCATTATTATCCACAAGCAAAACTCATTGAATCTGATGAAGAACTCCAAGCTTGGTGGTTAGAGATTAAAAATGTTGGACATGGTGACAAGAAAGATGAGCCATGGTGGCCAGAGTTAAAAACTCCAAATGACTTAATTAGTATTGTCACAACAATAATTTGGGTAACTTCTGGCCATCATGCAGCTGTAAACTTTGGCCAATACAGCTATGCAGGCTATTTTCCAAATAGGCCAACAATTGCTAGGTCAAAAATGCCAACTGAAGATCCAACAGATGAAGAATGGGAAGACTTTTTGAACAAACCTGAGGAGGCATTGTTAAAATGCTTCCCTTCACAACTTCAAGCAACAAAAGTAATAGCAGTTTTGGATGTTTTATCAAACCATTCTCCAGATGAAGAGTATATTGGTACAAATATTGAACCTTTTTGGAAAGATGAACCCGTAATTAATGCGGCGTTCGAGGTATTTTCGGGGAAATTGAAGGAGCTTGAAGGGATAATTGATGCCAGAAATGCTGATTGTAATTTGAAGAATAGAAATGGAGCTGGAGTTATGCCTTATGAATTATTGAAACCATTTTCTGAACGTGGAATTACTGGAAAAGGTGTACCTTATAGCATTTCCATTTGA


Protein sequences

Name Description Sequence
lipoxygenase lipoxygenase [Lycopersicon esculentum].

LRTHCCTEPYIIASNRQLSAMHPIYRLLFPHFRYTMEINGTAREALINANGVIESSFSPGKYSMELSSVAYDLHWRFDREALPEDLISRGLAEENPNAPYVLRLTIEDYPSASDGLVWDILKQWVTNYVNHYYPQAKLIESDEELQAWWLEIKNVGHGDKKDEPWWPELKTPNDLISIVTTIIWVTSGHHAAVNFGQYSYAGYFPNRPTIARSKMPTEDPTDEEWEDFLNKPEEALLKCFPSQLQATKVIAVLDVLSNHSPDEEYIGTNIEPFWKDEPVINAAFEVFSGKLKELEGIIDARNADCNLKNRNGAGVMPYELLKPFSERGITGKGVPYSISI

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR11771:SF2
1-340 PTHR11771:SF2,LIPOXYGENASE

LRTHCCTEPYIIASNRQLSAMHPIYRLLFPHFRYTMEINGTAREALINANGVIESSFSPGKYSMELSSVAYDLHWRFDREALPEDLISRGLAEENPNAPYVLRLTIEDYPSASDGLVWDILKQWVTNYVNHYYPQAKLIESDEELQAWWLEIKNVGHGDKKDEPWWPELKTPNDLISIVTTIIWVTSGHHAAVNFGQYSYAGYFPNRPTIARSKMPTEDPTDEEWEDFLNKPEEALLKCFPSQLQATKVIAVLDVLSNHSPDEEYIGTNIEPFWKDEPVINAAFEVFSGKLKELEGIIDARNADCNLKNRNGAGVMPYELLKPFSERGITGKGVPYSISI

HMMPanther: PTHR11771
IPR000907
1-340 LipOase
Lipoxygenase

LRTHCCTEPYIIASNRQLSAMHPIYRLLFPHFRYTMEINGTAREALINANGVIESSFSPGKYSMELSSVAYDLHWRFDREALPEDLISRGLAEENPNAPYVLRLTIEDYPSASDGLVWDILKQWVTNYVNHYYPQAKLIESDEELQAWWLEIKNVGHGDKKDEPWWPELKTPNDLISIVTTIIWVTSGHHAAVNFGQYSYAGYFPNRPTIARSKMPTEDPTDEEWEDFLNKPEEALLKCFPSQLQATKVIAVLDVLSNHSPDEEYIGTNIEPFWKDEPVINAAFEVFSGKLKELEGIIDARNADCNLKNRNGAGVMPYELLKPFSERGITGKGVPYSISI

superfamily: SSF48484
IPR013819
1-340 Lipoxygenase
Lipoxygenase, C-terminal

LRTHCCTEPYIIASNRQLSAMHPIYRLLFPHFRYTMEINGTAREALINANGVIESSFSPGKYSMELSSVAYDLHWRFDREALPEDLISRGLAEENPNAPYVLRLTIEDYPSASDGLVWDILKQWVTNYVNHYYPQAKLIESDEELQAWWLEIKNVGHGDKKDEPWWPELKTPNDLISIVTTIIWVTSGHHAAVNFGQYSYAGYFPNRPTIARSKMPTEDPTDEEWEDFLNKPEEALLKCFPSQLQATKVIAVLDVLSNHSPDEEYIGTNIEPFWKDEPVINAAFEVFSGKLKELEGIIDARNADCNLKNRNGAGVMPYELLKPFSERGITGKGVPYSISI

Gene3D: G3DSA:1.20.245.10
1-340 G3DSA:1.20.245.10

LRTHCCTEPYIIASNRQLSAMHPIYRLLFPHFRYTMEINGTAREALINANGVIESSFSPGKYSMELSSVAYDLHWRFDREALPEDLISRGLAEENPNAPYVLRLTIEDYPSASDGLVWDILKQWVTNYVNHYYPQAKLIESDEELQAWWLEIKNVGHGDKKDEPWWPELKTPNDLISIVTTIIWVTSGHHAAVNFGQYSYAGYFPNRPTIARSKMPTEDPTDEEWEDFLNKPEEALLKCFPSQLQATKVIAVLDVLSNHSPDEEYIGTNIEPFWKDEPVINAAFEVFSGKLKELEGIIDARNADCNLKNRNGAGVMPYELLKPFSERGITGKGVPYSISI

ProfileScan: PS51393
IPR013819
1-340 LIPOXYGENASE_3
Lipoxygenase, C-terminal

LRTHCCTEPYIIASNRQLSAMHPIYRLLFPHFRYTMEINGTAREALINANGVIESSFSPGKYSMELSSVAYDLHWRFDREALPEDLISRGLAEENPNAPYVLRLTIEDYPSASDGLVWDILKQWVTNYVNHYYPQAKLIESDEELQAWWLEIKNVGHGDKKDEPWWPELKTPNDLISIVTTIIWVTSGHHAAVNFGQYSYAGYFPNRPTIARSKMPTEDPTDEEWEDFLNKPEEALLKCFPSQLQATKVIAVLDVLSNHSPDEEYIGTNIEPFWKDEPVINAAFEVFSGKLKELEGIIDARNADCNLKNRNGAGVMPYELLKPFSERGITGKGVPYSISI

HMMPfam: PF00305
IPR013819
1-323 Lipoxygenase
Lipoxygenase, C-terminal

LRTHCCTEPYIIASNRQLSAMHPIYRLLFPHFRYTMEINGTAREALINANGVIESSFSPGKYSMELSSVAYDLHWRFDREALPEDLISRGLAEENPNAPYVLRLTIEDYPSASDGLVWDILKQWVTNYVNHYYPQAKLIESDEELQAWWLEIKNVGHGDKKDEPWWPELKTPNDLISIVTTIIWVTSGHHAAVNFGQYSYAGYFPNRPTIARSKMPTEDPTDEEWEDFLNKPEEALLKCFPSQLQATKVIAVLDVLSNHSPDEEYIGTNIEPFWKDEPVINAAFEVFSGKLKELEGIIDARNADCNLKNRNGAGVMPYELLKP

PatternScan: PS00081
IPR020834
21-31 LIPOXYGENASE_2
Lipoxygenase, conserved site

MHPIYRLLFPH


List of References

M Parniske, B B Wulff, G Bonnema, C M Thomas, D A Jones, J D Jones
Homologues of the Cf-9 disease resistance gene (Hcr9s) are present at multiple loci on the short arm of tomato chromosome 1.
Mol. Plant Microbe Interact.: 1999, 12(2);93-102
PubMed:9926411 WorldCat.org DOI (P p)

M Parniske, J D Jones
Recombination between diverged clusters of the tomato Cf-9 plant disease resistance gene family.
Proc. Natl. Acad. Sci. U.S.A.: 1999, 96(10);5850-5
PubMed:10318973 WorldCat.org (P p)





List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox