PRGDB00049695 (ys105)

From PRG Wiki
Jump to: navigation, search
ys105
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 21263075 (AF510991)
Gene Class Unknown
Domain Type Ser-Thr Kinase, Ser-Thr Kinase, Ser-Thr Kinase
Gene Species Oryza rufipogon

Comment?

Oryza rufipogon serine/threonine protein kinase (ys105) gene, partial cds.

DNA Sequence

TTCGGGTCGGTGTACCGGGGGATTTCTCCCCTGGTGGAATTCAGGTTGCTTGTGAAGGTGTTGGTCCATGTTTNGGCAATGGCTGACCAAGATGCTGCAAGAGAGCTTGAGCGGCTGGGACGGATCAAACATCCTAATTTGGTTCCTTTGACTGGTTACTGCTTAGCAGGGGAGCAGAGAATCGCCATCTACGAGTACATGGAGAACGGCAATCTGCACAACCTACTTCATGACTTGCCTCTAGGAGTCCAGACCACTGAGGATTGGAGCACTGACACATGGGAAGACAACAATGGCGGTGTTGCCACCGAAAACATCACACCAGAGGGTACCGCGACATGGATGTTCCGGCACAAGATTGCATTAGGCGCCGCGAGGGCACTGGCATTCCTGCACCACGGCTGCATCCCTCAGATCGTCCACCGTGACGTGAAGGCGAGCAGCATCTACTTCGACTGTGGGATGGAGCCTAGGCTGTCTGACTTCGGGCTGTCAATGATCGCCGGGACCAGCACGGACAACAACCTGCTGCACCATTCCCCGGGCTACGCCCCACCGGAGTTCTCCGACTCGGAGAACGCCATGGCGACAGCAAAGTCCGACATC


Protein sequences

Name Description Sequence
serine/threonine protein kinase serine/threonine protein kinase [Oryza rufipogon].

FGSVYRGISPLVEFRLLVKVLVHVXAMADQDAARELERLGRIKHPNLVPLTGYCLAGEQRIAIYEYMENGNLHNLLHDLPLGVQTTEDWSTDTWEDNNGGVATENITPEGTATWMFRHKIALGAARALAFLHHGCIPQIVHRDVKASSIYFDCGMEPRLSDFGLSMIAGTSTDNNLLHHSPGYAPPEFSDSENAMATAKSDI

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-202 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

FGSVYRGISPLVEFRLLVKVLVHVXAMADQDAARELERLGRIKHPNLVPLTGYCLAGEQRIAIYEYMENGNLHNLLHDLPLGVQTTEDWSTDTWEDNNGGVATENITPEGTATWMFRHKIALGAARALAFLHHGCIPQIVHRDVKASSIYFDCGMEPRLSDFGLSMIAGTSTDNNLLHHSPGYAPPEFSDSENAMATAKSDI

HMMPfam: PF00069
IPR000719
1-202 Pkinase,Ser-thr
Protein kinase, catalytic domain

FGSVYRGISPLVEFRLLVKVLVHVXAMADQDAARELERLGRIKHPNLVPLTGYCLAGEQRIAIYEYMENGNLHNLLHDLPLGVQTTEDWSTDTWEDNNGGVATENITPEGTATWMFRHKIALGAARALAFLHHGCIPQIVHRDVKASSIYFDCGMEPRLSDFGLSMIAGTSTDNNLLHHSPGYAPPEFSDSENAMATAKSDI

Gene3D: G3DSA:3.30.200.20
1-53 G3DSA:3.30.200.20

FGSVYRGISPLVEFRLLVKVLVHVXAMADQDAARELERLGRIKHPNLVPLTGY

HMMPanther: PTHR24420
1-202 PTHR24420,FAMILY NOT NAMED

FGSVYRGISPLVEFRLLVKVLVHVXAMADQDAARELERLGRIKHPNLVPLTGYCLAGEQRIAIYEYMENGNLHNLLHDLPLGVQTTEDWSTDTWEDNNGGVATENITPEGTATWMFRHKIALGAARALAFLHHGCIPQIVHRDVKASSIYFDCGMEPRLSDFGLSMIAGTSTDNNLLHHSPGYAPPEFSDSENAMATAKSDI

superfamily: SSF56112
IPR011009
1-202 Kinase_like
Protein kinase-like domain

FGSVYRGISPLVEFRLLVKVLVHVXAMADQDAARELERLGRIKHPNLVPLTGYCLAGEQRIAIYEYMENGNLHNLLHDLPLGVQTTEDWSTDTWEDNNGGVATENITPEGTATWMFRHKIALGAARALAFLHHGCIPQIVHRDVKASSIYFDCGMEPRLSDFGLSMIAGTSTDNNLLHHSPGYAPPEFSDSENAMATAKSDI

HMMPanther: PTHR24420:SF73
1-202 PTHR24420:SF73,SUBFAMILY NOT NAMED

FGSVYRGISPLVEFRLLVKVLVHVXAMADQDAARELERLGRIKHPNLVPLTGYCLAGEQRIAIYEYMENGNLHNLLHDLPLGVQTTEDWSTDTWEDNNGGVATENITPEGTATWMFRHKIALGAARALAFLHHGCIPQIVHRDVKASSIYFDCGMEPRLSDFGLSMIAGTSTDNNLLHHSPGYAPPEFSDSENAMATAKSDI

Gene3D: G3DSA:1.10.510.10
54-202 G3DSA:1.10.510.10

CLAGEQRIAIYEYMENGNLHNLLHDLPLGVQTTEDWSTDTWEDNNGGVATENITPEGTATWMFRHKIALGAARALAFLHHGCIPQIVHRDVKASSIYFDCGMEPRLSDFGLSMIAGTSTDNNLLHHSPGYAPPEFSDSENAMATAKSDI






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox