PRGDB00050012 (Os05g0104200)

From PRG Wiki
Jump to: navigation, search
Os05g0104200
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 115461602 (NM_001060936)
Gene Class Unknown
Domain Type LRR, LRR, Ser-Thr Kinase, Ser-Thr Kinase
Gene Species Oryza sativa Japonica Group

Comment?

Oryza sativa (japonica cultivar-group) Os05g0104200 (Os05g0104200) mRNA, complete cds.

DNA Sequence

ATGGATGTGAAGCTCCTGCTGCTGCTGCTGCTGTCCGTCCTCCTCCTGTCTGCTGCCTCCATGGCCAAGGACGACGATGAGCAGCAGCAGAAGGTGCAATGCCATGAGGACGACGAGGCGGCGCTTCTGGCCATCGACGACGCCCTCGGGAACCCCTACAATTTGGCGTCGTGGACGCGCAACACCTCCTGCTGCGACTGGTACGACGTGGACTGCGACCAGGACTCTGGCCGCGTCGTCTCCCTCTCCGTCTTCCAGGACACCAACCTCACCGGCGCCATCCCCGACGCCATCGCCAACCTCACCCACCTCCGCACCCTCCTCCTCCACCACCTCCCCAGCCTCTCCGGCCCCATCCCCGACTCCCTCGCCGCCCTCACCGACCTCACCCACCTCACCATCTCCTGGACCGCCGTCTCCGGCCCCGTCCCCTCCTTCCTCGCCAACCTCACCTCCCTCACCATGCTCGATCTCTCCTTCAACTCCCTCACCGGCCTCATCCCGCCCTCCCTCGCCGCCCTCACCAATCTCTCCGCCATCAACCTCAGCCGCAACCGCCTCTCCGGCCCCATCCCGCCGGGCCTCTTCTCCAACCTGCAGCTGCAGGACGACGACGACGAGGTGTACCTCCGGCTGTCGCACAACAACCTGTCCGGGAGCGTCCCGGCGGACCTGCTGGCGGCGGCGAACCTGGCGCTGGTGGACCTGTCGCGGAACGCGCTGACCGGCGACGCGTCGGCGGTGTTCCGGCGGGCAAGGTACGTGGACCTGTCGCGAAACGGCTTCGTCTTCAACATGTCCGGCGTGGAGTTCGCGGAGGAGACGTACTACGTGGACGTGAGCCACAACGCCATCCGCGGGGGGATCCCGGCGCAGGTGGCCAACCTCACCAACCTGCAGACGTTCAACGTCAGCTACAACAAGATGTGCGGCGCGGTGCCCGCCATGCCCAGGTTCGACGCCTACTGCTACCAACACAACAAATGCCTCTGCGGCGCTCCCCTCGCCACCGCCTGCCGTCGTCGATAA


Protein sequences

Name Description Sequence
hypothetical protein Os05g0104200 [Oryza sativa (japonica cultivar-group)].

MDVKLLLLLLLSVLLLSAASMAKDDDEQQQKVQCHEDDEAALLAIDDALGNPYNLASWTRNTSCCDWYDVDCDQDSGRVVSLSVFQDTNLTGAIPDAIANLTHLRTLLLHHLPSLSGPIPDSLAALTDLTHLTISWTAVSGPVPSFLANLTSLTMLDLSFNSLTGLIPPSLAALTNLSAINLSRNRLSGPIPPGLFSNLQLQDDDDEVYLRLSHNNLSGSVPADLLAAANLALVDLSRNALTGDASAVFRRARYVDLSRNGFVFNMSGVEFAEETYYVDVSHNAIRGGIPAQVANLTNLQTFNVSYNKMCGAVPAMPRFDAYCYQHNKCLCGAPLATACRRR


Domains

Domain Start-End Description Sequence

HMMPanther: PTHR24420
1-342 PTHR24420,FAMILY NOT NAMED

MDVKLLLLLLLSVLLLSAASMAKDDDEQQQKVQCHEDDEAALLAIDDALGNPYNLASWTRNTSCCDWYDVDCDQDSGRVVSLSVFQDTNLTGAIPDAIANLTHLRTLLLHHLPSLSGPIPDSLAALTDLTHLTISWTAVSGPVPSFLANLTSLTMLDLSFNSLTGLIPPSLAALTNLSAINLSRNRLSGPIPPGLFSNLQLQDDDDEVYLRLSHNNLSGSVPADLLAAANLALVDLSRNALTGDASAVFRRARYVDLSRNGFVFNMSGVEFAEETYYVDVSHNAIRGGIPAQVANLTNLQTFNVSYNKMCGAVPAMPRFDAYCYQHNKCLCGAPLATACRRR

HMMPanther: PTHR24420:SF540
1-342 PTHR24420:SF540

MDVKLLLLLLLSVLLLSAASMAKDDDEQQQKVQCHEDDEAALLAIDDALGNPYNLASWTRNTSCCDWYDVDCDQDSGRVVSLSVFQDTNLTGAIPDAIANLTHLRTLLLHHLPSLSGPIPDSLAALTDLTHLTISWTAVSGPVPSFLANLTSLTMLDLSFNSLTGLIPPSLAALTNLSAINLSRNRLSGPIPPGLFSNLQLQDDDDEVYLRLSHNNLSGSVPADLLAAANLALVDLSRNALTGDASAVFRRARYVDLSRNGFVFNMSGVEFAEETYYVDVSHNAIRGGIPAQVANLTNLQTFNVSYNKMCGAVPAMPRFDAYCYQHNKCLCGAPLATACRRR

superfamily: SSF52058
32-339 SSF52058,LRR

VQCHEDDEAALLAIDDALGNPYNLASWTRNTSCCDWYDVDCDQDSGRVVSLSVFQDTNLTGAIPDAIANLTHLRTLLLHHLPSLSGPIPDSLAALTDLTHLTISWTAVSGPVPSFLANLTSLTMLDLSFNSLTGLIPPSLAALTNLSAINLSRNRLSGPIPPGLFSNLQLQDDDDEVYLRLSHNNLSGSVPADLLAAANLALVDLSRNALTGDASAVFRRARYVDLSRNGFVFNMSGVEFAEETYYVDVSHNAIRGGIPAQVANLTNLQTFNVSYNKMCGAVPAMPRFDAYCYQHNKCLCGAPLATAC

Gene3D: G3DSA:3.80.10.10
33-335 G3DSA:3.80.10.10

QCHEDDEAALLAIDDALGNPYNLASWTRNTSCCDWYDVDCDQDSGRVVSLSVFQDTNLTGAIPDAIANLTHLRTLLLHHLPSLSGPIPDSLAALTDLTHLTISWTAVSGPVPSFLANLTSLTMLDLSFNSLTGLIPPSLAALTNLSAINLSRNRLSGPIPPGLFSNLQLQDDDDEVYLRLSHNNLSGSVPADLLAAANLALVDLSRNALTGDASAVFRRARYVDLSRNGFVFNMSGVEFAEETYYVDVSHNAIRGGIPAQVANLTNLQTFNVSYNKMCGAVPAMPRFDAYCYQHNKCLCGAPL

HMMPfam: PF08263
IPR013210
36-73 LRRNT_2
Leucine-rich repeat-containing N-terminal, type 2

EDDEAALLAIDDALGNPYNLASWTRNTSCCDWYDVDCD

HMMPfam: PF13855
151-200 LRR_8,Leucine rich repeat

TSLTMLDLSFNSLTGLIPPSLAALTNLSAINLSRNRLSGPIPPGLFSNLQ

FPrintScan: PR00019
153-166 LEURICHRPT,Leucine-rich repeat signature

LTMLDLSFNSLTGL

FPrintScan: PR00019
174-187 LEURICHRPT,Leucine-rich repeat signature

LTNLSAINLSRNRL

HMMPfam: PF00560
IPR001611
209-226 LRR_1
Leucine-rich repeat

YLRLSHNNLSGSVPADLL


List of References

Hajime Ohyanagi, Tsuyoshi Tanaka, Hiroaki Sakai, Yasumasa Shigemoto, Kaori Yamaguchi, Takuya Habara, Yasuyuki Fujii, Baltazar A Antonio, Yoshiaki Nagamura, Tadashi Imanishi, Kazuho Ikeo, Takeshi Itoh, Takashi Gojobori, Takuji Sasaki
The Rice Annotation Project Database (RAP-DB): hub for Oryza sativa ssp. japonica genome information.
Nucleic Acids Res.: 2006, 34(Database issue);D741-4
PubMed:16381971 WorldCat.org DOI (I p)


The map-based sequence of the rice genome.
Nature: 2005, 436(7052);793-800
PubMed:16100779 WorldCat.org DOI (I p)





List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox