PRGDB00050117 (RGA4)

From PRG Wiki
Jump to: navigation, search
RGA4
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 154845409 (EU036666)
Gene Class Unknown
Domain Type LRR
Gene Species Lolium perenne

Comment?

Lolium perenne RGA4 gene, partial cds.

DNA Sequence

GCTGAGGGACATGAATGAGCTCTCTGGCAGTATAAATGTCAGATATCTCAATAATGTTACTGGGAAGGAGGAAGCTTTAGTGTCCAAGCTACACAGGAAAAGTCATCTTGAAGGCTTGGGCCCTATGTGGAGTTCTGAGAATGATATGATAGAAAATGCTAACTTGCATCTGGAGATTTTAGAAGGTTTGATGCCACCGCCCCAAGTTCGGCACCTTACACTCGAAGGTTACAAAGCTGCGAAATATCCAAGGTGGTTACTAGGAGGTTCATGTTTTGCGAGCATGGAAACCTTTAAGCTTGTTGATTGCGGCGCGTTAGAAGGCTTACCATCCAATACCGAGCTGTTTCGTAATTGCTCTGTACTTAGCCTTGAGAATATCCCAAACATGAAGACATTACCTTGTCTTCCAGCAAGCCTTGAACAGTTAACAATTGATAAATGCCCTCTGCTTATATTTATTTCTGATGATGAGCTGGAACAGCATGATCAGAGAGAGGCCATCATGAGGACAGACCACTTGGCATCACAACTTGCTTTGATCTGCGAGGTGGATCCAGAATCCGATATTAGGAGCATACTATTGTCAGAATGTTCATCTATGAAGCATTTGATTGCATTGATGGATGCTGATACGTCACATCTTGAAGCCATTGAAAGTGCTC


Protein sequences

Name Description Sequence
RGA4 RGA4 [Lolium perenne].

LRDMNELSGSINVRYLNNVTGKEEALVSKLHRKSHLEGLGPMWSSENDMIENANLHLEILEGLMPPPQVRHLTLEGYKAAKYPRWLLGGSCFASMETFKLVDCGALEGLPSNTELFRNCSVLSLENIPNMKTLPCLPASLEQLTIDKCPLLIFISDDELEQHDQREAIMRTDHLASQLALICEVDPESDIRSILLSECSSMKHLIALMDADTSHLEAIESA

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR23155:SF130
1-216 PTHR23155:SF130,OS01G0781700 PROTEIN

LRDMNELSGSINVRYLNNVTGKEEALVSKLHRKSHLEGLGPMWSSENDMIENANLHLEILEGLMPPPQVRHLTLEGYKAAKYPRWLLGGSCFASMETFKLVDCGALEGLPSNTELFRNCSVLSLENIPNMKTLPCLPASLEQLTIDKCPLLIFISDDELEQHDQREAIMRTDHLASQLALICEVDPESDIRSILLSECSSMKHLIALMDADTSHLE

HMMPanther: PTHR23155
1-216 PTHR23155,LRR,LEUCINE-RICH REPEAT-CONTAINING PROTEIN

LRDMNELSGSINVRYLNNVTGKEEALVSKLHRKSHLEGLGPMWSSENDMIENANLHLEILEGLMPPPQVRHLTLEGYKAAKYPRWLLGGSCFASMETFKLVDCGALEGLPSNTELFRNCSVLSLENIPNMKTLPCLPASLEQLTIDKCPLLIFISDDELEQHDQREAIMRTDHLASQLALICEVDPESDIRSILLSECSSMKHLIALMDADTSHLE






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox