PRGDB00050431 (Os05g0597700)

From PRG Wiki
Jump to: navigation, search
Os05g0597700
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 58530791 (AP008211)
Gene Class Unknown
Domain Type LRR, LRR, Ser-Thr Kinase, Ser-Thr Kinase
Gene Species Oryza sativa Japonica Group

Comment?

Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5.

DNA Sequence

ATGGATGTGAAGCTCCTGCTGCTGCTGCTGCTGTCCGTCCTCCTCCTGTCTGCTGCCTCCATGGCCAAGGACGACGATGAGCAGCAGCAGAAGGTGCAATGCCATGAGGACGACGAGGCGGCGCTTCTGGCCATCGACGACGCCCTCGGGAACCCCTACAATTTGGCGTCGTGGACGCGCAACACCTCCTGCTGCGACTGGTACGACGTGGACTGCGACCAGGACTCTGGCCGCGTCGTCTCCCTCTCCGTCTTCCAGGACACCAACCTCACCGGCGCCATCCCCGACGCCATCGCCAACCTCACCCACCTCCGCACCCTCCTCCTCCACCACCTCCCCAGCCTCTCCGGCCCCATCCCCGACTCCCTCGCCGCCCTCACCGACCTCACCCACCTCACCATCTCCTGGACCGCCGTCTCCGGCCCCGTCCCCTCCTTCCTCGCCAACCTCACCTCCCTCACCATGCTCGATCTCTCCTTCAACTCCCTCACCGGCCTCATCCCGCCCTCCCTCGCCGCCCTCACCAATCTCTCCGCCATCAACCTCAGCCGCAACCGCCTCTCCGGCCCCATCCCGCCGGGCCTCTTCTCCAACCTGCAGCTGCAGGACGACGACGACGAGGTGTACCTCCGGCTGTCGCACAACAACCTGTCCGGGAGCGTCCCGGCGGACCTGCTGGCGGCGGCGAACCTGGCGCTGGTGGACCTGTCGCGGAACGCGCTGACCGGCGACGCGTCGGCGGTGTTCCGGCGGGCAAGGTACGTGGACCTGTCGCGAAACGGCTTCGTCTTCAACATGTCCGGCGTGGAGTTCGCGGAGGAGACGTACTACGTGGACGTGAGCCACAACGCCATCCGCGGGGGGATCCCGGCGCAGGTGGCCAACCTCACCAACCTGCAGACGTTCAACGTCAGCTACAACAAGATGTGCGGCGCGGTGCCCGCCATGCCCAGGTTCGACGCCTACTGCTACCAACACAACAAATGCCTCTGCGGCGCTCCCCTCGCCACCGCCTGCCGTCGTCGATAA



Domains

Domain Start-End Description Sequence

HMMPanther: PTHR24420
1-342 PTHR24420,FAMILY NOT NAMED

MDVKLLLLLLLSVLLLSAASMAKDDDEQQQKVQCHEDDEAALLAIDDALGNPYNLASWTRNTSCCDWYDVDCDQDSGRVVSLSVFQDTNLTGAIPDAIANLTHLRTLLLHHLPSLSGPIPDSLAALTDLTHLTISWTAVSGPVPSFLANLTSLTMLDLSFNSLTGLIPPSLAALTNLSAINLSRNRLSGPIPPGLFSNLQLQDDDDEVYLRLSHNNLSGSVPADLLAAANLALVDLSRNALTGDASAVFRRARYVDLSRNGFVFNMSGVEFAEETYYVDVSHNAIRGGIPAQVANLTNLQTFNVSYNKMCGAVPAMPRFDAYCYQHNKCLCGAPLATACRRR

HMMPanther: PTHR24420:SF540
1-342 PTHR24420:SF540

MDVKLLLLLLLSVLLLSAASMAKDDDEQQQKVQCHEDDEAALLAIDDALGNPYNLASWTRNTSCCDWYDVDCDQDSGRVVSLSVFQDTNLTGAIPDAIANLTHLRTLLLHHLPSLSGPIPDSLAALTDLTHLTISWTAVSGPVPSFLANLTSLTMLDLSFNSLTGLIPPSLAALTNLSAINLSRNRLSGPIPPGLFSNLQLQDDDDEVYLRLSHNNLSGSVPADLLAAANLALVDLSRNALTGDASAVFRRARYVDLSRNGFVFNMSGVEFAEETYYVDVSHNAIRGGIPAQVANLTNLQTFNVSYNKMCGAVPAMPRFDAYCYQHNKCLCGAPLATACRRR

superfamily: SSF52058
32-339 SSF52058,LRR

VQCHEDDEAALLAIDDALGNPYNLASWTRNTSCCDWYDVDCDQDSGRVVSLSVFQDTNLTGAIPDAIANLTHLRTLLLHHLPSLSGPIPDSLAALTDLTHLTISWTAVSGPVPSFLANLTSLTMLDLSFNSLTGLIPPSLAALTNLSAINLSRNRLSGPIPPGLFSNLQLQDDDDEVYLRLSHNNLSGSVPADLLAAANLALVDLSRNALTGDASAVFRRARYVDLSRNGFVFNMSGVEFAEETYYVDVSHNAIRGGIPAQVANLTNLQTFNVSYNKMCGAVPAMPRFDAYCYQHNKCLCGAPLATAC

Gene3D: G3DSA:3.80.10.10
33-335 G3DSA:3.80.10.10

QCHEDDEAALLAIDDALGNPYNLASWTRNTSCCDWYDVDCDQDSGRVVSLSVFQDTNLTGAIPDAIANLTHLRTLLLHHLPSLSGPIPDSLAALTDLTHLTISWTAVSGPVPSFLANLTSLTMLDLSFNSLTGLIPPSLAALTNLSAINLSRNRLSGPIPPGLFSNLQLQDDDDEVYLRLSHNNLSGSVPADLLAAANLALVDLSRNALTGDASAVFRRARYVDLSRNGFVFNMSGVEFAEETYYVDVSHNAIRGGIPAQVANLTNLQTFNVSYNKMCGAVPAMPRFDAYCYQHNKCLCGAPL

HMMPfam: PF08263
IPR013210
36-73 LRRNT_2
Leucine-rich repeat-containing N-terminal, type 2

EDDEAALLAIDDALGNPYNLASWTRNTSCCDWYDVDCD

HMMPfam: PF13855
151-200 LRR_8,Leucine rich repeat

TSLTMLDLSFNSLTGLIPPSLAALTNLSAINLSRNRLSGPIPPGLFSNLQ

FPrintScan: PR00019
153-166 LEURICHRPT,Leucine-rich repeat signature

LTMLDLSFNSLTGL

FPrintScan: PR00019
174-187 LEURICHRPT,Leucine-rich repeat signature

LTNLSAINLSRNRL

HMMPfam: PF00560
IPR001611
209-226 LRR_1
Leucine-rich repeat

YLRLSHNNLSGSVPADLL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox