PRGDB00050628 (Pto-like receptor kinase resistance protein)

From PRG Wiki
Jump to: navigation, search
Pto-like receptor kinase resistance protein
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 47498965 (AY583628)
Gene Class Unknown
Domain Type Ser-Thr Kinase, Ser-Thr Kinase
Gene Species Rosa roxburghii

Comment?

Rosa roxburghii clone STK4 Pto-like receptor kinase resistance protein gene, partial cds.

DNA Sequence

TGGGGCAAGGGGGGTTCGGGGTTGGCTTGTTGAAATCGCCGACTATGGAATGAATGACGGGTTCGCCTTAATGGGGCTCCGGTTGGGTGGTGGATCGGTTGTAATCTCCTGCGCGTCGGTGGTCTCCGTTGTGCAGGTGGTTTCGGATTTAATGGAGGATGGAAGGAACCCCGTCGAGGACGAAGTCGGGGAACAGTCAACAACCCAACTGTTGCAGATCAGTGGGTCCCACGCCGATAGCTCGCTTCTTCACTCGCCTGAAAACCGCGCGTGCTCTTCACTTGCCGGATTTAACCGTGGTCTACCTGGACCTTGGTCCATATTAGAATTTTTGAAATGGGTAGCCAAGGTTTCCGATTTTGGGTTGTCAAAAATGGGCAATATCACAATGTCCAAGACCCATATTAGCACGAAGGTGAAGGGTAGTTTCAGATATCTTGATCCTGATTACTACCGGCGTCAACAATTGACTGAGAAGTCTGACGTTTACTCCTTTGGCGT


Protein sequences

Name Description Sequence
Pto-like receptor kinase resistance protein Pto-like receptor kinase resistance protein [Rosa roxburghii].

GARGVRGWLVEIADYGMNDGFALMGLRLGGGSVVISCASVVSVVQVVSDLMEDGRNPVEDEVGEQSTTQLLQISGSHADSSLLHSPENRACSSLAGFNRGLPGPWSILEFLKWVAKVSDFGLSKMGNITMSKTHISTKVKGSFRYLDPDYYRRQQLTEKSDVYSFGV

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-167 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

GARGVRGWLVEIADYGMNDGFALMGLRLGGGSVVISCASVVSVVQVVSDLMEDGRNPVEDEVGEQSTTQLLQISGSHADSSLLHSPENRACSSLAGFNRGLPGPWSILEFLKWVAKVSDFGLSKMGNITMSKTHISTKVKGSFRYLDPDYYRRQQLTEKSDVYSFGV

HMMPanther: PTHR24420
112-167 PTHR24420,FAMILY NOT NAMED

KWVAKVSDFGLSKMGNITMSKTHISTKVKGSFRYLDPDYYRRQQLTEKSDVYSFGV

superfamily: SSF56112
IPR011009
112-167 Kinase_like
Protein kinase-like domain

KWVAKVSDFGLSKMGNITMSKTHISTKVKGSFRYLDPDYYRRQQLTEKSDVYSFGV

HMMPanther: PTHR24420:SF418
112-167 PTHR24420:SF418,SUBFAMILY NOT NAMED

KWVAKVSDFGLSKMGNITMSKTHISTKVKGSFRYLDPDYYRRQQLTEKSDVYSFGV

Gene3D: G3DSA:1.10.510.10
113-167 G3DSA:1.10.510.10

WVAKVSDFGLSKMGNITMSKTHISTKVKGSFRYLDPDYYRRQQLTEKSDVYSFGV

HMMPfam: PF07714
IPR001245
114-167 Pkinase_Tyr
Serine-threonine/tyrosine-protein kinase catalytic

VAKVSDFGLSKMGNITMSKTHISTKVKGSFRYLDPDYYRRQQLTEKSDVYSFGV






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox