PRGDB00050710 (567C)

From PRG Wiki
Jump to: navigation, search
567C
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 30023640 (AY123941)
Gene Class Unknown
Domain Type LRR
Gene Species Aegilops tauschii

Comment?

Aegilops tauschii 567C (567C) gene, partial cds.

DNA Sequence

GGGCCTGGCTCTTGCGCCTATGGAGAATGGAGGAGGAATTCACGAGGACAAGTCATTGCTCCAATCATTATCAATATTCAACTGTGGCAACTTGTTGTGTCAGTGGCCCATGGTAGAGTCAGAGACCATTTACCCTTTCCCTGCTTCCCTGAGGGAACTTGATGTTTACCTAGACACAAGCATGAAGTCAATGGCTCTGCTGTCAAACCTCACTTCTCTCACCACTCTAAGGCTAAAAGACTGCAGCAATTTAACAGTGGACGGATTCAATCCTCTCATCGCAGTCAACCTCATACAACTGGAAGTGCATAGGTGCAGCACCTTAGCAGCAGATATGCTCTCAGAGGTGGCAAGGACCAAATTATTGCCTGCAGGTTACATCTCTAGATTAGAGGTGCTCACGGTGGATGACATCTCTGGATTGCTTGCTGCTCCTATTTGCATCCTCCTTGCCCCGGCCCTACACACACTTAAATTCTTGTTTGATAAGAGCATGGAAAGCTTCACGGAAGAGCAAGACAAAGCGCTGCATCTCCTCACCTTCCTCCAGAAACTAAGTTTTCACTCTTGCAGGCGTTTGCAGTCCCTTTCTCAAGGGTTGCATCGCCTTTCTTCTCTTAAGGAGTTACATGTCCTTTGGTGTCCAAAAATCCGATCGATGCCCAAGGAGGGCCTCCCCGTGTTCACTGAGAAAACTAAAGATGGGATTGTCCCAACGCTGAAATAG


Protein sequences

Name Description Sequence
567C 567C [Aegilops tauschii].

GLALAPMENGGGIHEDKSLLQSLSIFNCGNLLCQWPMVESETIYPFPASLRELDVYLDTSMKSMALLSNLTSLTTLRLKDCSNLTVDGFNPLIAVNLIQLEVHRCSTLAADMLSEVARTKLLPAGYISRLEVLTVDDISGLLAAPICILLAPALHTLKFLFDKSMESFTEEQDKALHLLTFLQKLSFHSCRRLQSLSQGLHRLSSLKELHVLWCPKIRSMPKEGLPVFTEKTKDGIVPTLK

Domains

Domain Start-End Description Sequence

superfamily: SSF52047
20-221 SSF52047,LRR

LQSLSIFNCGNLLCQWPMVESETIYPFPASLRELDVYLDTSMKSMALLSNLTSLTTLRLKDCSNLTVDGFNPLIAVNLIQLEVHRCSTLAADMLSEVARTKLLPAGYISRLEVLTVDDISGLLAAPICILLAPALHTLKFLFDKSMESFTEEQDKALHLLTFLQKLSFHSCRRLQSLSQGLHRLSSLKELHVLWCPKIRSMP

Gene3D: G3DSA:3.80.10.10
20-216 G3DSA:3.80.10.10

LQSLSIFNCGNLLCQWPMVESETIYPFPASLRELDVYLDTSMKSMALLSNLTSLTTLRLKDCSNLTVDGFNPLIAVNLIQLEVHRCSTLAADMLSEVARTKLLPAGYISRLEVLTVDDISGLLAAPICILLAPALHTLKFLFDKSMESFTEEQDKALHLLTFLQKLSFHSCRRLQSLSQGLHRLSSLKELHVLWCPK


List of References



List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox