PRGDB00062135 (disease resistance protein (TIR-NBS-LRR class))

From PRG Wiki
Jump to: navigation, search
disease resistance protein (TIR-NBS-LRR class)
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 223403542 (FJ613394)
Gene Class TNL
Domain Type LRR, TIR, NBS
Gene Species Arabidopsis thaliana

Comment?

Arabidopsis thaliana ecotype H55 disease resistance protein (TIR-NBS-LRR class) (At5g44870) mRNA, partial cds.

DNA Sequence

GGCTGTACAGAACTGGAGAGTCTTCCCAAACGTCTTGGAAAACAGAAAGCTCTTCAAGAACTGGTACTCTCTGGATGTTCAAAGCTCGAGAGTGTTCCAACGGTCGTACAAGACATGAAACATCTACGGATCTTATTGCTTGACGGCACAAGAATCAGAAAGATCCCGAAGATAAAGTCGCTAAAGTGTTTGTGCTTAAGTAGAAATATTGCAATGGTCAATCTACAAGATAATCTCAAAGATTTCTATTATCTGAAATGTCTTGTCATGAAGAACTGCGAGAATCTCAGATATCTTCCTCCGCTTCCAAAATGTCTTGAGTACCTAAACGTATATGGTTGTGAAAGACTAGAATCAGTTGAGAATCCACTGGTTTCTGATAGGTTATTCCTTGATGGATTGGAGAAATTACGTTCCACTTTCTTGTTCACTAATTGCCACAATCTGTTTCAAGATGCAAAGGACTCAATCTCAACCTACGCGAAATGGAAATGCCACCGACTTGCAGTTGAATGCTACGAACAGGACAAAGTTTCTGGAGCTTTTTTCAACACTTGCTATCCTGGATATATAGTCCCCTCGTGGTTCGACCACCAAGCAGTTGGATCAGTCTTAGAGCCAAGGCTGGAACCACATTGGTATAACACTATGCTTTCTGGGATAGCTCTATGTGCAGTTGTATCATTCCATGAGAACCAAGATCCGATCATCGGCAGTTTCTCAGTAAAATGCACATTGCAATTTGAAAACGAAGATGGGTCTCTTCGCTTTGATTGTGATATCGGATGTTTGAACGAACCAGGAATGATTGAGGCAGACCATGTTTTTATCGGCTATGTCACTTGCTCACGTTTGAAAGATCACCACTCTATACCTATTCATCACCCTACAACTGTAAAAATGAAGTTCCACTTGACTGATGCTTGTAAAAGTAAAGTGGTGGATTGTGGGTTCCGTTTGATGTACACCCAGAGCCGTGGCTGTTTGTTAAGGGAAGAAGTCGCCGCCAACTTCACTAAATTATAA


Protein sequences

Name Description Sequence
disease resistance protein (TIR-NBS-LRR class) disease resistance protein (TIR-NBS-LRR class) [Arabidopsis thaliana].

GCTELESLPKRLGKQKALQELVLSGCSKLESVPTVVQDMKHLRILLLDGTRIRKIPKIKSLKCLCLSRNIAMVNLQDNLKDFYYLKCLVMKNCENLRYLPPLPKCLEYLNVYGCERLESVENPLVSDRLFLDGLEKLRSTFLFTNCHNLFQDAKDSISTYAKWKCHRLAVECYEQDKVSGAFFNTCYPGYIVPSWFDHQAVGSVLEPRLEPHWYNTMLSGIALCAVVSFHENQDPIIGSFSVKCTLQFENEDGSLRFDCDIGCLNEPGMIEADHVFIGYVTCSRLKDHHSIPIHHPTTVKMKFHLTDACKSKVVDCGFRLMYTQSRGCLLREEVAANFTKL


Domains

Domain Start-End Description Sequence

superfamily: SSF52047
1-137 SSF52047,LRR

GCTELESLPKRLGKQKALQELVLSGCSKLESVPTVVQDMKHLRILLLDGTRIRKIPKIKSLKCLCLSRNIAMVNLQDNLKDFYYLKCLVMKNCENLRYLPPLPKCLEYLNVYGCERLESVENPLVSDRLFLDGLEKL

HMMPanther: PTHR23155:SF68
1-158 PTHR23155:SF68,DISEASE RESISTANCE PROTEIN (TIR-NBS-LRR CLASS)

GCTELESLPKRLGKQKALQELVLSGCSKLESVPTVVQDMKHLRILLLDGTRIRKIPKIKSLKCLCLSRNIAMVNLQDNLKDFYYLKCLVMKNCENLRYLPPLPKCLEYLNVYGCERLESVENPLVSDRLFLDGLEKLRSTFLFTNCHNLFQDAKDSIS

HMMPanther: PTHR23155
1-158 PTHR23155,LRR,LEUCINE-RICH REPEAT-CONTAINING PROTEIN

GCTELESLPKRLGKQKALQELVLSGCSKLESVPTVVQDMKHLRILLLDGTRIRKIPKIKSLKCLCLSRNIAMVNLQDNLKDFYYLKCLVMKNCENLRYLPPLPKCLEYLNVYGCERLESVENPLVSDRLFLDGLEKLRSTFLFTNCHNLFQDAKDSIS

Gene3D: G3DSA:3.80.10.10
6-119 G3DSA:3.80.10.10

ESLPKRLGKQKALQELVLSGCSKLESVPTVVQDMKHLRILLLDGTRIRKIPKIKSLKCLCLSRNIAMVNLQDNLKDFYYLKCLVMKNCENLRYLPPLPKCLEYLNVYGCERLES

ProfileScan: PS51450
IPR001611
41-62 LRR,Leucine-rich repeat profile.
Leucine-rich repeat

HLRILLLDGTRIRKIPKIKSLK






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox