PRGDB00062278 (NBS-LRR disease resistance protein RGA4-like protein)

From PRG Wiki
Jump to: navigation, search
NBS-LRR disease resistance protein RGA4-like protein
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 226446430 (FJ826513)
Gene Class NL
Domain Type NBS, LRR
Gene Species Areca catechu

Comment?

Areca catechu NBS-LRR disease resistance protein RGA4-like protein gene, partial cds.

DNA Sequence

TGGGGGAGTGGGGAAGACGACTCTTGCTCAATTAGTGTTCAATGATAGCAGGGCTAATAGTGAGATTTTTGAGACGCGAATTTGGGTATGCGTGTCTGCTGATTTCACTTTGAGAACAATTGTACGACCTATACTGGATGCCACCAAGGAGAGGTGCGATATAAACAACTTGGAATCCATAGCAAGTTGCCTTTCAAGGGTGTTTACCGAGAGGCGGTATTTGTTGGTTCTGGATGATTGTTGGAACGAGAATCAGGATGAATGGGAGAAATTGAAACTTCTGTTGAAAGATGGCAAGAGGGGAAGTAAAATCATAGTGACCACACGCAGCAAAAAAGTCGCCATGATAATGAAGACCGTGGAACCTTTCCATTTGAAGGGTCTATCGAATGATGACTGTTGGGAGCTTTTCAAGCGGAAGGCATTCGAGAAGGGGGAAGAGGAGAAGTATCCGAGCTTGGTGATAATTGGAATGGAGATTGTCAAGAAATGTGGAGGCGTGCCACTAGCA


Protein sequences

Name Description Sequence
NBS-LRR disease resistance protein RGA4-like protein NBS-LRR disease resistance protein RGA4-like protein [Areca catechu].

GGVGKTTLAQLVFNDSRANSEIFETRIWVCVSADFTLRTIVRPILDATKERCDINNLESIASCLSRVFTERRYLLVLDDCWNENQDEWEKLKLLLKDGKRGSKIIVTTRSKKVAMIMKTVEPFHLKGLSNDDCWELFKRKAFEKGEEEKYPSLVIIGMEIVKKCGGVPLA

Domains

Domain Start-End Description Sequence

HMMPfam: PF00931
IPR002182
1-170 NB-ARC,NBS
NB-ARC

GGVGKTTLAQLVFNDSRANSEIFETRIWVCVSADFTLRTIVRPILDATKERCDINNLESIASCLSRVFTERRYLLVLDDCWNENQDEWEKLKLLLKDGKRGSKIIVTTRSKKVAMIMKTVEPFHLKGLSNDDCWELFKRKAFEKGEEEKYPSLVIIGMEIVKKCGGVPLA

superfamily: SSF52540
1-170 SSF52540

GGVGKTTLAQLVFNDSRANSEIFETRIWVCVSADFTLRTIVRPILDATKERCDINNLESIASCLSRVFTERRYLLVLDDCWNENQDEWEKLKLLLKDGKRGSKIIVTTRSKKVAMIMKTVEPFHLKGLSNDDCWELFKRKAFEKGEEEKYPSLVIIGMEIVKKCGGVPLA

HMMPanther: PTHR23155:SF123
1-101 PTHR23155:SF123,NBS-LRR DISEASE RESISTANCE PROTEIN-LIKE (PUTATIVE UNCHARACTERIZED PROTEIN) (OS01

GGVGKTTLAQLVFNDSRANSEIFETRIWVCVSADFTLRTIVRPILDATKERCDINNLESIASCLSRVFTERRYLLVLDDCWNENQDEWEKLKLLLKDGKRG

HMMPanther: PTHR23155
1-101 PTHR23155,LRR,LEUCINE-RICH REPEAT-CONTAINING PROTEIN

GGVGKTTLAQLVFNDSRANSEIFETRIWVCVSADFTLRTIVRPILDATKERCDINNLESIASCLSRVFTERRYLLVLDDCWNENQDEWEKLKLLLKDGKRG

Gene3D: G3DSA:3.40.50.300
2-111 G3DSA:3.40.50.300

GVGKTTLAQLVFNDSRANSEIFETRIWVCVSADFTLRTIVRPILDATKERCDINNLESIASCLSRVFTERRYLLVLDDCWNENQDEWEKLKLLLKDGKRGSKIIVTTRSK






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox