PRGDB00062279 (disease resistance protein I2)

From PRG Wiki
Jump to: navigation, search
disease resistance protein I2
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 226430860 (FJ843082)
Gene Class Unknown
Domain Type
Gene Species Solanum lycopersicum

Comment?

Solanum lycopersicum cultivar Heamsona disease resistance protein I2 gene, partial cds.

DNA Sequence

TCTCACCTCACTTCGCTTCAAACTCTACAAATCTGGAATTTCCTTAATCTCCAATCACTTGCTGAATCAGCACTGCCCTCCTCCCTCTCTCACCTGGAGATAGATGATTGCCCTAATCTCCAATCACTCTTCGAATCAGCACTGCCCTCCTCCCT


Protein sequences

Name Description Sequence
disease resistance protein I2 disease resistance protein I2 [Solanum lycopersicum].

SHLTSLQTLQIWNFLNLQSLAESALPSSLSHLEIDDCPNLQSLFESALPSSL







List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox