PRGDB00063172 (lipid transfer protein)

From PRG Wiki
Jump to: navigation, search
lipid transfer protein
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 329762909 (HQ425639)
Gene Class Unknown
Domain Type
Gene Species Dimocarpus longan

Comment?

Dimocarpus longan cultivar Honghezi lipid transfer protein (LTP) mRNA, complete cds.

DNA Sequence

ATGGCTGCGCTCAAGCTTGTTTGTGCTTTGGTGGCTTGCATGTTGGTGGTCTCACCAGTGGCTCAGGCTGCCATAACATGCGGTCAGGTCACAAGCAGCGTGGCTCCATGCATCCAGTACTTGAGGTCTGGTGGGAGTGTACCTCCACCATGCTGCAATGGAATCAAGTCTCTCAACAACGCTGCTCGTACCACTCCTGATCGCCAACAGGCTTGCAGGTGCTTGCAAAACGCTGCTAAGGCCATCCCTGGCATCAACACTAACCTCGCCGCCGGCCTCCCAGGCAAGTGCGGTGTCAACATTCCTTACAAGATCAGCACCTCCACCAACTGCGCTTCGGTCAAGTGA


Protein sequences

Name Description Sequence
lipid transfer protein lipid transfer protein [Dimocarpus longan].

MAALKLVCALVACMLVVSPVAQAAITCGQVTSSVAPCIQYLRSGGSVPPPCCNGIKSLNNAARTTPDRQQACRCLQNAAKAIPGINTNLAAGLPGKCGVNIPYKISTSTNCASVK

lipid transfer protein lipid transfer protein [Dimocarpus longan].

MAALKLVCALVACMLVVSPVAQAAITCGQVTSSVAPCIQYLRSGGSVPPPCCNGIKSLNNAARTTPDRQQACRCLQNAAKAIPGINTNLAAGLPGKCGVNIPYKISTSTNCASVK

Domains

Domain Start-End Description Sequence

Gene3D: G3DSA:1.10.110.10
IPR013770
24-115 LPT_helical
Plant lipid transfer protein/hydrophobic protein h

AITCGQVTSSVAPCIQYLRSGGSVPPPCCNGIKSLNNAARTTPDRQQACRCLQNAAKAIPGINTNLAAGLPGKCGVNIPYKISTSTNCASVK

Gene3D: G3DSA:1.10.110.10
IPR013770
24-115 LPT_helical
Plant lipid transfer protein/hydrophobic protein h

AITCGQVTSSVAPCIQYLRSGGSVPPPCCNGIKSLNNAARTTPDRQQACRCLQNAAKAIPGINTNLAAGLPGKCGVNIPYKISTSTNCASVK

superfamily: SSF47699
IPR016140
25-115 Bifunc_inhib/LTP/seed_store
Bifunctional inhibitor/plant lipid transfer protei

ITCGQVTSSVAPCIQYLRSGGSVPPPCCNGIKSLNNAARTTPDRQQACRCLQNAAKAIPGINTNLAAGLPGKCGVNIPYKISTSTNCASVK

superfamily: SSF47699
IPR016140
25-115 Bifunc_inhib/LTP/seed_store
Bifunctional inhibitor/plant lipid transfer protei

ITCGQVTSSVAPCIQYLRSGGSVPPPCCNGIKSLNNAARTTPDRQQACRCLQNAAKAIPGINTNLAAGLPGKCGVNIPYKISTSTNCASVK

FPrintScan: PR00382
IPR000528
26-42 LIPIDTRNSFER
Plant lipid transfer protein/Par allergen

TCGQVTSSVAPCIQYLR

FPrintScan: PR00382
IPR000528
26-42 LIPIDTRNSFER
Plant lipid transfer protein/Par allergen

TCGQVTSSVAPCIQYLR

HMMSmart: SM00499
IPR016140
27-111 AAI
Bifunctional inhibitor/plant lipid transfer protei

CGQVTSSVAPCIQYLRSGGSVPPPCCNGIKSLNNAARTTPDRQQACRCLQNAAKAIPGINTNLAAGLPGKCGVNIPYKISTSTNC

HMMPfam: PF00234
IPR016140
27-111 Tryp_alpha_amyl
Bifunctional inhibitor/plant lipid transfer protei

CGQVTSSVAPCIQYLRSGGSVPPPCCNGIKSLNNAARTTPDRQQACRCLQNAAKAIPGINTNLAAGLPGKCGVNIPYKISTSTNC

HMMPfam: PF00234
IPR016140
27-111 Tryp_alpha_amyl
Bifunctional inhibitor/plant lipid transfer protei

CGQVTSSVAPCIQYLRSGGSVPPPCCNGIKSLNNAARTTPDRQQACRCLQNAAKAIPGINTNLAAGLPGKCGVNIPYKISTSTNC

HMMSmart: SM00499
IPR016140
27-111 AAI
Bifunctional inhibitor/plant lipid transfer protei

CGQVTSSVAPCIQYLRSGGSVPPPCCNGIKSLNNAARTTPDRQQACRCLQNAAKAIPGINTNLAAGLPGKCGVNIPYKISTSTNC

FPrintScan: PR00382
IPR000528
46-60 LIPIDTRNSFER
Plant lipid transfer protein/Par allergen

SVPPPCCNGIKSLNN

FPrintScan: PR00382
IPR000528
46-60 LIPIDTRNSFER
Plant lipid transfer protein/Par allergen

SVPPPCCNGIKSLNN

FPrintScan: PR00382
IPR000528
67-82 LIPIDTRNSFER
Plant lipid transfer protein/Par allergen

DRQQACRCLQNAAKAI

FPrintScan: PR00382
IPR000528
67-82 LIPIDTRNSFER
Plant lipid transfer protein/Par allergen

DRQQACRCLQNAAKAI

FPrintScan: PR00382
IPR000528
84-101 LIPIDTRNSFER
Plant lipid transfer protein/Par allergen

GINTNLAAGLPGKCGVNI

FPrintScan: PR00382
IPR000528
84-101 LIPIDTRNSFER
Plant lipid transfer protein/Par allergen

GINTNLAAGLPGKCGVNI

PatternScan: PS00597
IPR000528
93-114 PLANT_LTP
Plant lipid transfer protein/Par allergen

LPGKCGVNIPYKISTSTNCASV

PatternScan: PS00597
IPR000528
93-114 PLANT_LTP
Plant lipid transfer protein/Par allergen

LPGKCGVNIPYKISTSTNCASV

FPrintScan: PR00382
IPR000528
102-113 LIPIDTRNSFER
Plant lipid transfer protein/Par allergen

PYKISTSTNCAS

FPrintScan: PR00382
IPR000528
102-113 LIPIDTRNSFER
Plant lipid transfer protein/Par allergen

PYKISTSTNCAS






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox