PRGDB00063242 (NBS-LRR resistance protein)

From PRG Wiki
Jump to: navigation, search
NBS-LRR resistance protein
Gene Type Putative_R-Genes,_collected_from_NCBI_Protein
GenBank 258642372 (GQ480400)
Gene Class NL
Domain Type NBS, LRR, Others
Gene Species Hevea brasiliensis

Comment?

Hevea brasiliensis clone HevRTRGA2 NBS-LRR resistance protein mRNA, partial cds.

DNA Sequence

GGCGTTGGGAAAACCACCTTGGCGAAACAAGTCTATGATGATTCAGAAGTAAAGAAACATTTCAGCATGCATGCCTGGATAACAGTGTCTAGATCTTACAAGATGGAAGAACTCCTTAAAGACATTGTTCAACAACTCTTCAGTGCAGATAGGAAGCCAGTTCCCAGAGAAGCAGACAACATGAACAGCAATCAGCTGAAAACAATAATTAAGGAGCTGCTTCAGAACAGAAGGTACCTAATTGTTTTGGATGATGTATGGCATATAAATGAGTGGGATGCCGTCAAATATGCCTTGCCCACCAACAACTGTGGCAGCCGAGTCATTCTCACTACACGCAATGCTGATCTTGCCTTCACCTCACGCATAGAATATGAAGGTAAGGTCTATTACTTGGAGCCATTGCCTCCAGAAGAGTCTTGGACTCTTTTCTGCAGGAAGACATTCCAAGGGAACTTATGTCCTCATCATTTGGAGGATATTTGCAAAAGCATACTCAGAAAATGTGAGGGACTCCCGCTGGCCCTC


Protein sequences

Name Description Sequence
NBS-LRR resistance protein NBS-LRR resistance protein [Hevea brasiliensis].

GVGKTTLAKQVYDDSEVKKHFSMHAWITVSRSYKMEELLKDIVQQLFSADRKPVPREADNMNSNQLKTIIKELLQNRRYLIVLDDVWHINEWDAVKYALPTNNCGSRVILTTRNADLAFTSRIEYEGKVYYLEPLPPEESWTLFCRKTFQGNLCPHHLEDICKSILRKCEGLPLAL

Domains

Domain Start-End Description Sequence

Gene3D: G3DSA:3.40.50.300
1-117 G3DSA:3.40.50.300

GVGKTTLAKQVYDDSEVKKHFSMHAWITVSRSYKMEELLKDIVQQLFSADRKPVPREADNMNSNQLKTIIKELLQNRRYLIVLDDVWHINEWDAVKYALPTNNCGSRVILTTRNADL

HMMPfam: PF00931
IPR002182
1-176 NB-ARC,NBS
NB-ARC

GVGKTTLAKQVYDDSEVKKHFSMHAWITVSRSYKMEELLKDIVQQLFSADRKPVPREADNMNSNQLKTIIKELLQNRRYLIVLDDVWHINEWDAVKYALPTNNCGSRVILTTRNADLAFTSRIEYEGKVYYLEPLPPEESWTLFCRKTFQGNLCPHHLEDICKSILRKCEGLPLAL

superfamily: SSF52540
1-176 SSF52540

GVGKTTLAKQVYDDSEVKKHFSMHAWITVSRSYKMEELLKDIVQQLFSADRKPVPREADNMNSNQLKTIIKELLQNRRYLIVLDDVWHINEWDAVKYALPTNNCGSRVILTTRNADLAFTSRIEYEGKVYYLEPLPPEESWTLFCRKTFQGNLCPHHLEDICKSILRKCEGLPLAL

HMMPanther: PTHR11017:SF20
1-176 PTHR11017:SF20,SUBFAMILY NOT NAMED

GVGKTTLAKQVYDDSEVKKHFSMHAWITVSRSYKMEELLKDIVQQLFSADRKPVPREADNMNSNQLKTIIKELLQNRRYLIVLDDVWHINEWDAVKYALPTNNCGSRVILTTRNADLAFTSRIEYEGKVYYLEPLPPEESWTLFCRKTFQGNLCPHHLEDICKSILRKCEGLPLAL

HMMPanther: PTHR11017
1-176 PTHR11017,LEUCINE-RICH REPEAT-CONTAINING PROTEIN

GVGKTTLAKQVYDDSEVKKHFSMHAWITVSRSYKMEELLKDIVQQLFSADRKPVPREADNMNSNQLKTIIKELLQNRRYLIVLDDVWHINEWDAVKYALPTNNCGSRVILTTRNADLAFTSRIEYEGKVYYLEPLPPEESWTLFCRKTFQGNLCPHHLEDICKSILRKCEGLPLAL

FPrintScan: PR00364
IPR000767
73-87 DISEASERSIST
Disease resistance protein

LLQNRRYLIVLDDVW

FPrintScan: PR00364
IPR000767
169-176 DISEASERSIST
Disease resistance protein

CEGLPLAL






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox