PRGDB00063921 (Zm.3349)

From PRG Wiki
Jump to: navigation, search
Zm.3349
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 194691987 (BT035073)
Gene Class Mlo-like
Domain Type MLO
Gene Species Zea mays

Comment?

Zea mays full-length cDNA clone ZM_BFb0036B22 mRNA, complete cds

DNA Sequence

CTGCTGCCTCTGCAGGCTCTGCAAGGCTGCTAGCTGACCAAACTCCCCCTCCTCCGACCTTCCCGAATTTCTGATGCTGTTGCCACTTGAATGCTCTCCTCTCGCGCGGTGCCTGCCGTTGCTGCTCTGATGCCGATGGATCCCGCGCCGACCCAACCGCATCCGCATGCCACCCACCTCCCCTCCGCCTCGATCCGCATTAATTACTCCGACCTCACCACTTCCTCGCCGCTTCCAAATCCCAATAATACCATCGCGTAAATCCAGATATCAGGGCAGCTGGAACTGAAGGTGGCGGGAGCCGAGTGATCCGGCGGTGAGCTGAGCGGGGCGGGATGGCGGCGGAGCAGGGGCGGTCGCTGGCGGAGACGCCCACCTGGTCCGTGGCAACCGTCACCACGCTCATGGTCGCTGCCTGCTTCCTCGTCGAGCGCTCCCTCTCGCGCTTCGCCAAGTGGCTGCGCAAGACCAAGCGGAAGGCCATGCTCGCCGCGCTCGAGAAGATCCGCGAAGAGCTGATGCTGCTCGGAGTCATCTCGCTGCTGCTCAGCCAGACGGCGCGCTTCATATCGGAGATCTGCGTGCCGTCCTCGCTCTTCACCAGCCGCTTCTACATCTGCTCCGAGAGCGACTACCAGGACCTGCTGCGCAACACGGACGCCAACCAGACGGCGCTCGACAAGAACATGTTCGGTGGCCAACGGCTGCACGTCTGTGGCGAGGGCCATGAACCTTTTGTTTCGTACGAGGGCCTTGAGCAGCTGCACCGGTTTCTCTTCATCCTTGGTATCACTCATGTGTTGTACAGTTTTGTAACAGTGGTTCTGTCCATGATCAAGATCTATAGCTGGAGGAAGTGGGAAACCTTAGCAGGTCCAATTGCTGCTGAGGAATTGAAAGCTAGGAGAACCAAGGTGATGAGAAGGCAGTCAACCTTTGTTTTTAACAATGCTTCTCATCCATGGAGCAAAAATAAAATACTTATTTGGATGCTTTGCTTTTTGCGTCAATTCAAGGGCTCCATAATAAGGTCAGACTATTTGGCACTGAGGTTGGGCTTTGTCACATATCACAAGCTACCACATTCATATGACTTCCATAAATACATGGTACGGAGCATGGAAGATGATTACAATGGGACTATTGGTATCAGTTGGCCACTTTGGGCATATGCGATTGTCTGCATATTAATCAATGTTCATGGTATCAATATATATTTCTGGTTGTCCTTTGTTCCTGTTATTCTGGTGCTTCTAGTGGGTACTGAACTTCAGCACGTCATTGCTCAGTTGGCTTTGGAAGTCGCTGAGGCAACAGCGCCTTATGTTGGCTCACAACTTAAACTGCGTGATGATCTATTTTGGTTTGGAAAGCCTCGGGTACTCTGGTGGCTTATACAGTTCATTTCATTTCAGAATGCTTTTGAGCTGGCAACATTCTTATGGTCTCTGTGGGAACTCAGTGCACAAACATGTTTCATGAAGCACTACTACATGGTTGCCATTCGGTTGATTTCTGGGCTCCTAGTTCAGTTTTGGTGCAGCTACAGCACACTGCCGCTGAATGTGATTATTTCTCAGATGGGTTCCAAGTTCAAGAAATCACTGGTCTCGGAGAACGTGAGGGAGTCGCTGCACAGCTGGTGCAAGAGGGTTAAGGACAGGAGCCGACACAATCCGCTCTTCTCGCGGAACGGGACCCTCACGACCAGATCCGTGTGCTCCCTAGACACCACCTACGAGACGGATCACGAGACGAACACGGTGTGCACGCTGTCGAGGACGGCGTCGGCGACGTCGCTGGACGACCAGTTGACCGTGGTCACCGTCGATGACGAGCCGTCCTGCATTGAGAAGGATGTCTGACGCAGTTGCTGATTCGCCAAAACTACATACTGCACCGACCTGTGTGTTAGGAGGTACTCTAGGACTGAAATGAATGTATATGTGCAGTGGTTGCCCCTATCGTGGCAGTGACCATGTGTATATATAGAACTAAAAAAACTATAATGTCTCTTAGCTGAGAGTGAGAGGCTGTACATGGAAATACTTGAGGCAGCTTGGACCAAATACAAAACTGCATCTTTTCGAG


Protein sequences

Name Description Sequence
Zm.3349 translated coding region predicted by ESTScan from UniGene Zm.3349

XAASAGSARLLADQTPPPPTFPNFXCCCHLNALLSRGACRCCSDADGSRADPTASACHPPPLRLDPHXLLRPHHFLAASKSQXYHRVNPDIRAAGTEGGGSRVIRRXAERGGMAAEQGRSLAETPTWSVATVTTLMVAACFLVERSLSRFAKWLRKTKRKAMLAALEKIREELMLLGVISLLLSQTARFISEICVPSSLFTSRFYICSESDYQDLLRNTDANQTALDKNMFGGQRLHVCGEGHEPFVSYEGLEQLHRFLFILGITHVLYSFVTVVLSMIKIYSWRKWETLAGPIAAEELKARRTKVMRRQSTFVFNNASHPWSKNKILIWMLCFLRQFKGSIIRSDYLALRLGFVTYHKLPHSYDFHKYMVRSMEDDYNGTIGISWPLWAYAIVCILINVHGINIYFWLSFVPVILVLLVGTELQHVIAQLALEVAEATAPYVGSQLKLRDDLFWFGKPRVLWWLIQFISFQNAFELATFLWSLWELSAQTCFMKHYYMVAIRLISGLLVQFWCSYSTLPLNVIISQMGSKFKKSLVSENVRESLHSWCKRVKDRSRHNPLFSRNGTLTTRSVCSLDTTYETDHETNTVCTLSRTASATSLDDQLTVVTVDDEPSCIEKDV

Domains

Domain Start-End Description Sequence

Seg: seg
1-12 seg

XAASAGSARLLA

Seg: seg
15-28 seg

TPPPPTFPNFXCCC

Seg: seg
58-74 seg

HPPPLRLDPHXLLRPHH

HMMPfam: PF03094
IPR004326
117-574 Mlo
Mlo-related protein

QGRSLAETPTWSVATVTTLMVAACFLVERSLSRFAKWLRKTKRKAMLAALEKIREELMLLGVISLLLSQTARFISEICVPSSLFTSRFYICSESDYQDLLRNTDANQTALDKNMFGGQRLHVCGEGHEPFVSYEGLEQLHRFLFILGITHVLYSFVTVVLSMIKIYSWRKWETLAGPIAAEELKARRTKVMRRQSTFVFNNASHPWSKNKILIWMLCFLRQFKGSIIRSDYLALRLGFVTYHKLPHSYDFHKYMVRSMEDDYNGTIGISWPLWAYAIVCILINVHGINIYFWLSFVPVILVLLVGTELQHVIAQLALEVAEATAPYVGSQLKLRDDLFWFGKPRVLWWLIQFISFQNAFELATFLWSLWELSAQTCFMKHYYMVAIRLISGLLVQFWCSYSTLPLNVIISQMGSKFKKSLVSENVRESLHSWCKRVKDRSRHNPLFSRNGTLTTRSVC

Seg: seg
173-183 seg

LMLLGVISLLL

Seg: seg
601-612 seg

LDDQLTVVTVDD






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox