PRGDB00064013 (Zm.18699)

From PRG Wiki
Jump to: navigation, search
Zm.18699
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 78113080 (DV531474)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Zea mays

Comment?

ZM_BFb0221K06.r ZM_BFb Zea mays cDNA 5', mRNA sequence

DNA Sequence

ATTCTCCAAAGCATATAACCTCATGCACGTGTGGCAAGAAATATGTGACGTTTTTTGGCACCTTAAGGGCTTGTTCGGTTATTCCTAATACACATGGATTGGATGAGATTGGAAAAAATTGAGAAGAAGTTTGACTTGTTTGGGATTAAAACCATCTAATCCCACTCTCAATCCACATGGATTGAGAGGTAACCGAACAAGCCCTAACAGATCCGAAATCTTCTTGGCTACGTGCAGAAGTTCTATACCGCCACAGGGTTCGTGGCACGAGTAAGTTCTTGACGAACTCATTAGCTCGTATATACACCATGCACTACTGATCAAAGTTGATGCCCCTAACAGGCAGAGGCAGCGGCCCAATCTCAGGTCGACGGCAAACCTGAGAAGAACTCAACGGCGTACTTGGACGGATCGGCGAGCACCATGAGCGACCTCGGGACGGGCGGGGCATTGACGTCGACCAGCCCCTCCAGAACCTGCACCACCATCCCCATACTCGGGCGCAAGCTCTCCGCGTCCTGCACGCACCAGCACGCCACCTTGCAGGCCCGCTCCACCTCGGCCACGTCCGCGTTGCCGCCGAGCTGGCTGTCCACCGCGCTCCTCACGTCGCCGTCGAGGAGCCGGTTGACGGCCGTGGACGGGAAGAAGTCCACCGTGCCGTCCGCCCGCTGGCCGACATTCCTCCGGCCCGAGATGATCTCGAACAGCATCATGCCGTAGCTGAACACGTCCGCCTTGGTGGTGACGGCCGTGCCGGCGATCCACTCGGGCGCCAGGTACCCCACCGTGCCC


Protein sequences

Name Description Sequence
Zm.18699 translated coding region predicted by ESTScan from UniGene Zm.18699

XGTVGYLAPEWIAGTAVTTKADVFSYGMMLFEIISGRRNVGQRADGTVDFFPSTAVNRLLDGDVRSAVDSQLGGNADVAEVERACKVACWCVQDAESLRPSMGMVVQVLEGLVDVNAPPVPRSLMVLADPSKYAVEFFSGLPST

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-113 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XGTVGYLAPEWIAGTAVTTKADVFSYGMMLFEIISGRRNVGQRADGTVDFFPSTAVNRLLDGDVRSAVDSQLGGNADVAEVERACKVACWCVQDAESLRPSMGMVVQVLEGLV

Gene3D: G3DSA:1.10.510.10
2-107 no description

GTVGYLAPEWIAGTAVTTKADVFSYGMMLFEIISGRRNVGQRADGTVDFFPSTAVNRLLDGDVRSAVDSQLGGNADVAEVERACKVACWCVQDAESLRPSMGMVVQ

superfamily: SSF56112
IPR011009
2-136 Protein kinase-like (PK-like)
Protein kinase-like domain

GTVGYLAPEWIAGTAVTTKADVFSYGMMLFEIISGRRNVGQRADGTVDFFPSTAVNRLLDGDVRSAVDSQLGGNADVAEVERACKVACWCVQDAESLRPSMGMVVQVLEGLVDVNAPPVPRSLMVLADPSKYAVE

HMMPfam: PF00069
IPR017442
2-106 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

GTVGYLAPEWIAGTAVTTKADVFSYGMMLFEIISGRRNVGQRADGTVDFFPSTAVNRLLDGDVRSAVDSQLGGNADVAEVERACKVACWCVQDAESLRPSMGMVV

HMMPanther: PTHR24420
2-125 FAMILY NOT NAMED,FAMILY NOT NAMED

GTVGYLAPEWIAGTAVTTKADVFSYGMMLFEIISGRRNVGQRADGTVDFFPSTAVNRLLDGDVRSAVDSQLGGNADVAEVERACKVACWCVQDAESLRPSMGMVVQVLEGLVDVNAPPVPRSLM

HMMPanther: PTHR24420:SF442
2-125 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

GTVGYLAPEWIAGTAVTTKADVFSYGMMLFEIISGRRNVGQRADGTVDFFPSTAVNRLLDGDVRSAVDSQLGGNADVAEVERACKVACWCVQDAESLRPSMGMVVQVLEGLVDVNAPPVPRSLM






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox