PRGDB00064368 (Zm.94752)

From PRG Wiki
Jump to: navigation, search
Zm.94752
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 224033160 (BT068759)
Gene Class RLP
Domain Type Ser-Thr Kinase, LRR
Gene Species Zea mays

Comment?

Zea mays full-length cDNA clone ZM_BFb0374M16 mRNA, complete cds

DNA Sequence

CCAAAATCTCCACTCCCGGAGTGAGCTCCCCACCACCACCTCCGTCCCCAAATGTCCCGTCACCATCACCACGCCGCCACTATCGCTGCTGCCGTGCTCTTCCTCCTCACAGCGCCTCCTTGCGCCGCCGACCCTAACGACGAGCGTTGCCTGACTCACCTCCACCAGTCCCTCTCCGATTCCTCCGGAAGGCTCAACTGGACCAAGGCGGCGATCTCTGCGCCGTGCGACGGCTTCTTCTCGCACCTCCAAGGCGTCACCTGCAACAACGGGCGCGTGTACAAGCTAGCCCTCCCGGATCTCTCGCTCGGGGGCACCGTCCCGCCGGAGCTCTCCAACTGCACCAACCTCCAGTCGCTGGACCTGTCCGCGAACGCGCTGTCCGGCGCCATCCCGACGGAGCTCTCCGCGCTGCTGAACCTCGCCGTGCTCAACCTCTCCGCGAACGCGCTCTCTGGCGCCATCCCGCGGGAGCTCGCCAGCTGCGCCTACCTCAACGTCATAGATCTCCATGGCAACCAGCTGTCCGGCCCCATCCCCGAGGAACTCGGCCTCCTCGTCCGGCTCTCGACCTTCGACGTCTCCTACAACCGCCTCTCTGGCCCCATCCCCGTGCTCCTCGCCAACCGCTCCGGCGCCGGCACGGCAGCCGTCGGGACGGCGAGGTTCAACGCCAGCTCCTTCGTAGGGAACAAGGGCTTGTACGGGTACCCGCTGCCGCCGATGCGGACGCGGGGGCTCTCCGTGCTCGCCATCGTTGGCATCGGCCTTGGCAGCGGGCTGCTCAGCCTTGTGCTTAGCTTCTCCGCCGTGTGTCTGTGGCTCCGCGCCACGGACCGGCGGACTCCCACCACCCCTGGCGAGGAGGGCAAGATCTCCCAGCCCATGCCGAACTACTGAATCCATCAAAGGTTGCATCTTTGGACATATAATTCCTCGTAATTGAACTGAACACGAGATTTTTCAGCTGGGCTTGCAACAAAGGTTCCACCTTGAATAGATTTTGGTTGGATTCTTGAAGCCAGTATTGGATTCTGGAACGGGATCCGAGGAGCATACCAGACATCTTGCTGCAGGCTGGTTGTGTCAGTAGTGGATCTTCTAATCGCTGTAGCTTTTTAATAACTAATGATTTTGTTGT


Protein sequences

Name Description Sequence
Zm.94752 translated coding region predicted by ESTScan from UniGene Zm.94752

XKISTPGVSSPPPPPSPNVPHHHHAATIAAAVLFLLTAPPCAADPNDERCLTHLHQSLSDSSGRLNWTKAAISAPCDGFFSHLQGVTCNNGRVYKLALPDLSLGGTVPPELSNCTNLQSLDLSANALSGAIPTELSALLNLAVLNLSANALSGAIPRELASCAYLNVIDLHGNQLSGPIPEELGLLVRLSTFDVSYNRLSGPIPVLLANRSGAGTAAVGTARFNASSFVGNKGLYGYPLPPMRTRGLSVLAIVGIGLGSGLLSLVLSFSAVCLWLRATDRRTPTTPGEEGKISQPMPNY


Domains

Domain Start-End Description Sequence

Seg: seg
4-31 seg

STPGVSSPPPPPSPNVPHHHHAATIAAA

HMMPanther: PTHR24420:SF665
10-297 SUBFAMILY NOT NAMED

SPPPPPSPNVPHHHHAATIAAAVLFLLTAPPCAADPNDERCLTHLHQSLSDSSGRLNWTKAAISAPCDGFFSHLQGVTCNNGRVYKLALPDLSLGGTVPPELSNCTNLQSLDLSANALSGAIPTELSALLNLAVLNLSANALSGAIPRELASCAYLNVIDLHGNQLSGPIPEELGLLVRLSTFDVSYNRLSGPIPVLLANRSGAGTAAVGTARFNASSFVGNKGLYGYPLPPMRTRGLSVLAIVGIGLGSGLLSLVLSFSAVCLWLRATDRRTPTTPGEEGKISQPMP

HMMPanther: PTHR24420
10-297 FAMILY NOT NAMED,FAMILY NOT NAMED

SPPPPPSPNVPHHHHAATIAAAVLFLLTAPPCAADPNDERCLTHLHQSLSDSSGRLNWTKAAISAPCDGFFSHLQGVTCNNGRVYKLALPDLSLGGTVPPELSNCTNLQSLDLSANALSGAIPTELSALLNLAVLNLSANALSGAIPRELASCAYLNVIDLHGNQLSGPIPEELGLLVRLSTFDVSYNRLSGPIPVLLANRSGAGTAAVGTARFNASSFVGNKGLYGYPLPPMRTRGLSVLAIVGIGLGSGLLSLVLSFSAVCLWLRATDRRTPTTPGEEGKISQPMP

superfamily: SSF52058
41-209 L domain-like,LRR

CAADPNDERCLTHLHQSLSDSSGRLNWTKAAISAPCDGFFSHLQGVTCNNGRVYKLALPDLSLGGTVPPELSNCTNLQSLDLSANALSGAIPTELSALLNLAVLNLSANALSGAIPRELASCAYLNVIDLHGNQLSGPIPEELGLLVRLSTFDVSYNRLSGPIPVLLAN

Gene3D: G3DSA:3.80.10.10
45-209 no description

PNDERCLTHLHQSLSDSSGRLNWTKAAISAPCDGFFSHLQGVTCNNGRVYKLALPDLSLGGTVPPELSNCTNLQSLDLSANALSGAIPTELSALLNLAVLNLSANALSGAIPRELASCAYLNVIDLHGNQLSGPIPEELGLLVRLSTFDVSYNRLSGPIPVLLAN

HMMPfam: PF13516
114-133 LRR_6,Leucine Rich repeat

CTNLQSLDLSANALSGAIPT

FPrintScan: PR00019
117-130 LEURICHRPT,Leucine-rich repeat signature

LQSLDLSANALSGA

Seg: seg
135-152 seg

LSALLNLAVLNLSANALS

FPrintScan: PR00019
138-151 LEURICHRPT,Leucine-rich repeat signature

LLNLAVLNLSANAL

HMMPfam: PF00560
IPR001611
165-184 LRR_1
Leucine-rich repeat

LNVIDLHGNQLSGPIPEELG

Seg: seg
249-271 seg

VLAIVGIGLGSGLLSLVLSFSAV






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox