PRGDB00064413 (Zm.99853)

From PRG Wiki
Jump to: navigation, search
Zm.99853
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 219886074 (BT054805)
Gene Class Mlo-like
Domain Type MLO
Gene Species Zea mays

Comment?

Zea mays full-length cDNA clone ZM_BFb0067N07 mRNA, complete cds

DNA Sequence

GTCCGTGTAGGTCGCATGCAAGCTGGGCGACACTGCGTGCCGGGCGTCCTCCTTCCTCTGCTCCTTCCGATCCCCCTCCCGGCGTGGAGGTATAGCGTCCGCCATCTCCCCCGGCCGACCGGATCCCTCACCCCTCTAGGTACGTAGCTAGCTAGGCCAGGTTATCGTCGATTCGATAGATTCAATAAGCAAAGGCGATCAACAACACAATTAATGGGGGGCGGCGGCGGCGGCAACTCGCGGGAGCTGGACCAGACGCCGACATGGGCGGTGGCGTCGGTGTGCGGCGTGATCGTGCTCATCTCCATCCTGCTGGAGAAAGGGCTCCACCACGTGGGCGAGTTCTTCTCCCACCGCAAGAAGAAGGCCATGGTGGAGGCCCTGGAGAAGGTGAAGGCGGAGCTCATGGTGCTGGGCTTCATCTCCCTCCTCCTCGTGTTCGGCCAGAACTACATCGTCAAGGTGTGCATCAGCAACCACGCCGCCAACACTATGCTCCCCTGCAAGCTCAAGGAGGCCGCCGTCCCTGGCAAGAAGAAGGCCGCCGCAGCAGCAGAGCATCTCGGGGGCGTGCTGGACTGGCCGCCGCCCTACTACGCGCACAACGGCAGGATGCTGGCGGAGGCGAGCATGGCGACCAAGTGCCCCGAGGGGAAGGTGTCGCTCATCTCCATCAACGCCTTGCACCAGCTGCACATCTTCATCTTCTTCCTCGCCGTCTTCCACGTCTCCTACAGCGCCATCACCATGGCGCTCGGCAGGGCCAAGATACGCGCGTGGAAGGAGTGGGAGAAGGAAGCAGCAGGGCAGGACTACGAGTTCTCTAACGACCCTACGCGGTTCAGGTTCACCCACGAGACTTCGTTTGTGAGGCAGCATATGAATGTGCTCAACAAGTTCCCAGCATCCTTCTACATCAGCAACTTCTTCCGGCAGTTCTTCAGGTCCGTCAGGCGGGCAGACTACTGCGCGCTGCGCCACAGCTTTGTCAACGTCCATCTGGCCCCTGGCACCAAGTTTGATTTCCAAAAGTACATCAAGCGGTCTCTGGAGGACGACTTCAAGGTGATCGTGGGGATCAGCCCTCCTTTGTGGGCTTCTGCTCTCATCTTCCTATTCCTCAATGTCAATGGATGGCACACCATGCTCTGGATCTCCATCATGCCGGTGGTGATCATCCTGTCCGTGGGGACGAAGCTGCAGGGCATCATCTGCCGCATGGCGATCGACATCACGGAGCGGCACGCCGTGATCCAGGGCATCCCGCTGGTGCAGGTCAGCGACTCCTACTTCTGGTTCGCACGCCCAACCTTCGTGCTCTTCCTCATCCACTTCACCCTCTTCCAGAATGGCTTCCAGATCATCTACTTCCTCTGGATTCTGTATGAGTACGGGATGGACTCGTGCTTCAACGACTCCGAAGAATTCGTCTTTGCACGTCTCTGCCTTGGGGTGGTTGTTCAGGTGCTGTGCAGCTACGTGACGCTCCCTCTGTACGCGCTCGTCTCCCAGATGGGCTCCACCATGAAGCAGTCCATCTTCGACGAGCAGACCTCCAAGGCGCTCAAGAACTGGCGCGCCGGCGCCAAGAAGAAGGCCCCCACCGGCTCCAAGCACGGCGGCGGCTCCCCAACCGCCGCCGGCAGCCCCACCAAGGCCGACGGCGACGCGTAGGCGTAGCTAGCAGAGGGTCATCGATCGATTGATCGATCGATCCAGCTGTTCGTTCTACATATAACCTGTTACTTATTTGTATGTAATTGTACCAATAGCAATCGACACGCGTGCGCCGCATGCAATGTACCATGAAACTGCTGATAGCTAGAGAGCGACATTTTTCTTGTTTGGTTCGTT


Protein sequences

Name Description Sequence
Zm.99853 translated coding region predicted by ESTScan from UniGene Zm.99853

XPCRSHASWATLRAGRPPSSAPSDPPPGVEVXRPPSPPADRIPHPSRYELARPGYRRFDRFNKQRRSTTQLMGGGGGGNSRELDQTPTWAVASVCGVIVLISILLEKGLHHVGEFFSHRKKKAMVEALEKVKAELMVLGFISLLLVFGQNYIVKVCISNHAANTMLPCKLKEAAVPGKKKAAAAAEHLGGVLDWPPPYYAHNGRMLAEASMATKCPEGKVSLISINALHQLHIFIFFLAVFHVSYSAITMALGRAKIRAWKEWEKEAAGQDYEFSNDPTRFRFTHETSFVRQHMNVLNKFPASFYISNFFRQFFRSVRRADYCALRHSFVNVHLAPGTKFDFQKYIKRSLEDDFKVIVGISPPLWASALIFLFLNVNGWHTMLWISIMPVVIILSVGTKLQGIICRMAIDITERHAVIQGIPLVQVSDSYFWFARPTFVLFLIHFTLFQNGFQIIYFLWILYEYGMDSCFNDSEEFVFARLCLGVVVQVLCSYVTLPLYALVSQMGSTMKQSIFDEQTSKALKNWRAGAKKKAPTGSKHGGGSPTAAGSPTKADGDA

Domains

Domain Start-End Description Sequence

Seg: seg
17-27 seg

PPSSAPSDPPP

Seg: seg
73-78 seg

GGGGGG

HMMPfam: PF03094
IPR004326
80-541 Mlo
Mlo-related protein

SRELDQTPTWAVASVCGVIVLISILLEKGLHHVGEFFSHRKKKAMVEALEKVKAELMVLGFISLLLVFGQNYIVKVCISNHAANTMLPCKLKEAAVPGKKKAAAAAEHLGGVLDWPPPYYAHNGRMLAEASMATKCPEGKVSLISINALHQLHIFIFFLAVFHVSYSAITMALGRAKIRAWKEWEKEAAGQDYEFSNDPTRFRFTHETSFVRQHMNVLNKFPASFYISNFFRQFFRSVRRADYCALRHSFVNVHLAPGTKFDFQKYIKRSLEDDFKVIVGISPPLWASALIFLFLNVNGWHTMLWISIMPVVIILSVGTKLQGIICRMAIDITERHAVIQGIPLVQVSDSYFWFARPTFVLFLIHFTLFQNGFQIIYFLWILYEYGMDSCFNDSEEFVFARLCLGVVVQVLCSYVTLPLYALVSQMGSTMKQSIFDEQTSKALKNWRAGAKKKAPTGSKHGG

Seg: seg
171-185 seg

KEAAVPGKKKAAAAA






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox