PRGDB00064416 (Zm.100016)

From PRG Wiki
Jump to: navigation, search
Zm.100016
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 148999858 (EE036888)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Zea mays

Comment?

ZM_BFc0100G07.f ZM_BFc Zea mays cDNA clone ZM_BFc0100G07 5', mRNA sequence

DNA Sequence

CGCCAGCTGCCCCGCCCGTGGGGGTTCATCAGCACCGTCCCGTTCACCAGCTCGCCCGACACCGCCGCGCCTCTGCTCACAACGTTCCCCCTGTCGCCGGGCCACGACGCGCGGCCCGTTGGCGCGTGGGTGCAGCGCGCTTGTTGTTGTTGCCACTGGACAGCCGTCGTCGGCGAGCACTCCTGCTGCTGCATCTGCCTCTCGATGTCGTCGTCTTTAGGCTCCGGGTCACACCGCCCGACGTGCGGCGATGGCGTGAGGTTGAAGGCGGTGGCGATGGGAAGGTTCCGACGCTTGGCGCCGTGCTGGAGTGGTGCGATGGTGGCGAGGATGTGCACGACCTCCGTCATGGTGGGCCTGGCCTCGGGGTCCCACTGCAGGCACTCCCGCGCCAGGTGCGCCATGATCTGCATCTCCTCCGCCGGGAACTTGCCCTGCAGCGTCGGGTCCGGCAGCTCCGTGACCACCAGCCCGCTGTCCCGCAGCCGCGACGTCGCCCAGAGTACGAGGCTCTCGTCGGCCCTCGTCGACGACGACTTGTGGATGGGCTGCCGGCCGGTGATGAGCTCCAGCACAACGACGCCGAAGCTGAAGACGTCGGACTTGAGCGACGCCTTGCCCACGATGGCGTACTCCGGTGCGAAGTAGCCGAACGTGCCCAGCATCCGCGCCGGGGAGCTCGAGCAGCTGGTCACGCCGTCGTTCATCAGGCACTTGGCCATGCCGAGGTCAGTGATCTTGGCTCTGAACTTTGTCGTCCAGAAGGATGTTGGTGGACTTGATGTCGCGGT


Protein sequences

Name Description Sequence
Zm.100016 translated coding region predicted by ESTScan from UniGene Zm.100016

TATSSPPTSFWTTKFRAKITDLGMAKCLMNDGVTSCSSSPARMLGTFGYFAPEYAIVGKASLKSDVFSFGVVVLELITGRQPIHKSSSTRADESLVLWATSRLRDSGLVVTELPDPTLQGKFPAEEMQIMAHLARECLQWDPEARPTMTEVVHILATIAPLQHGAKRRNLPIATAFNLTPSPHVGRCDPEPKDDDIERQMQQQECSPTTAVQWQQQQARCTHAPTGRASWPGDRGNVVSRGAAVSGELVNGTVLMNPHGRGSWR

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-156 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

TATSSPPTSFWTTKFRAKITDLGMAKCLMNDGVTSCSSSPARMLGTFGYFAPEYAIVGKASLKSDVFSFGVVVLELITGRQPIHKSSSTRADESLVLWATSRLRDSGLVVTELPDPTLQGKFPAEEMQIMAHLARECLQWDPEARPTMTEVVHILA

Gene3D: G3DSA:1.10.510.10
13-155 no description

TKFRAKITDLGMAKCLMNDGVTSCSSSPARMLGTFGYFAPEYAIVGKASLKSDVFSFGVVVLELITGRQPIHKSSSTRADESLVLWATSRLRDSGLVVTELPDPTLQGKFPAEEMQIMAHLARECLQWDPEARPTMTEVVHIL

superfamily: SSF56112
IPR011009
14-153 Protein kinase-like (PK-like)
Protein kinase-like domain

KFRAKITDLGMAKCLMNDGVTSCSSSPARMLGTFGYFAPEYAIVGKASLKSDVFSFGVVVLELITGRQPIHKSSSTRADESLVLWATSRLRDSGLVVTELPDPTLQGKFPAEEMQIMAHLARECLQWDPEARPTMTEVVH

HMMPfam: PF00069
IPR017442
15-153 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

FRAKITDLGMAKCLMNDGVTSCSSSPARMLGTFGYFAPEYAIVGKASLKSDVFSFGVVVLELITGRQPIHKSSSTRADESLVLWATSRLRDSGLVVTELPDPTLQGKFPAEEMQIMAHLARECLQWDPEARPTMTEVVH

HMMPanther: PTHR24420:SF809
15-220 PROTEIN KINASE FAMILY PROTEIN

FRAKITDLGMAKCLMNDGVTSCSSSPARMLGTFGYFAPEYAIVGKASLKSDVFSFGVVVLELITGRQPIHKSSSTRADESLVLWATSRLRDSGLVVTELPDPTLQGKFPAEEMQIMAHLARECLQWDPEARPTMTEVVHILATIAPLQHGAKRRNLPIATAFNLTPSPHVGRCDPEPKDDDIERQMQQQECSPTTAVQWQQQQARC

HMMPanther: PTHR24420
15-220 FAMILY NOT NAMED,FAMILY NOT NAMED

FRAKITDLGMAKCLMNDGVTSCSSSPARMLGTFGYFAPEYAIVGKASLKSDVFSFGVVVLELITGRQPIHKSSSTRADESLVLWATSRLRDSGLVVTELPDPTLQGKFPAEEMQIMAHLARECLQWDPEARPTMTEVVHILATIAPLQHGAKRRNLPIATAFNLTPSPHVGRCDPEPKDDDIERQMQQQECSPTTAVQWQQQQARC






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox