PRGDB00064726 (Aan.11323)

From PRG Wiki
Jump to: navigation, search
Aan.11323
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 159696326 (EY092652)
Gene Class Unknown
Domain Type
Gene Species Artemisia annua

Comment?

CAZI20834.rev CAZI Artemisia annua normalized leaf library Artemisia annua cDNA clone CAZI20834 3', mRNA sequence

DNA Sequence

ATATGCTCACAAATGACTTGATAATATATTTATGTCTATATTTTACAAGTTGAAACGACTATGAGACCTAACTATCTCATTTGGAAGTTTAATGTCTTCAAGCAATAAGCATACATGAAAGCAAAAAAGACAGCAAAACCAACCAAAACTATAGCCACTGGTGCCATGAAATTTGGCTCATATCCAAAATGGTCTTTCACGTACCATTTGATGGTAGGATCATTCGGCATGCCAGGTACATTGATGGTGTTCTGTATATCGCCATATTGTGAAACAATCAAACCATAAACAGTCCACGCCAACGGGCAAATCCAGTAGTACCATATCCACCACCCGGGAATCCTGGGTCTTGGGATGAAGAAACCAGAAAAGAGATTGAAGAGTGAGTAGAATGCGGCTGCAAATATGGCTGCTACTTGGTGGTTTGGTGTAATGGAGACGGTCATCATTCCATAGTATGTGAAGTAAAGAAACGAGAAGAAGTTGATGAAGAAGAACCAAAAGAATTTAGCGGCTGTCCATTCAAAGCTCACCATGGCATACACTATAAGAGTGTAATATGTGGTTTGAATAAATACATATGGTATCTCCACAAAGACCTGTGCCATAGCGTATGGTAATGCAGAATACATTCCAGCAGCTGTTTCACGATAAAAGACTGTTCTTTCTGTTGCTACTATCGGTTGTACTGTCGAACAATTGTTAATACCAACGAANAGGACTGCAGCATACATAGCTCCTATAATTGTTTGTAAATCACCACTACTCTCCCTTTTCTTTCCGATTTTCCAAAATATGGTTCCAACCATAAGTGCACAAG


Protein sequences

Name Description Sequence
Aan.11323 translated coding region predicted by ESTScan from UniGene Aan.11323

XCALMVGTIFWKIGKKRESSGDLQTIIGAMYAAVLFVGINNCSTVQPIVATERTVFYRETAAGMYSALPYAMAQVFVEIPYVFIQTTYYTLIVYAMVSFEWTAAKFFWFFFINFFSFLYFTYYGMMTVSITPNHQVAAIFAAAFYSLFNLFSGFFIPRPRIPGWWIWYYWICPLAWTVYGLIVSQYGDIQNTINVPGMPNDPTIKWYVKDHFGYEPNFMAPVAIVLVGFAVFFAFMYAYCLKTLNFQMR


Domains

Domain Start-End Description Sequence

HMMPanther: PTHR19241:SF10
3-249 ATP-BINDING CASSETTE TRANSPORTER (PDR),ATP-BINDING CASSETTE TRANSPORTER (PDR)

ALMVGTIFWKIGKKRESSGDLQTIIGAMYAAVLFVGINNCSTVQPIVATERTVFYRETAAGMYSALPYAMAQVFVEIPYVFIQTTYYTLIVYAMVSFEWTAAKFFWFFFINFFSFLYFTYYGMMTVSITPNHQVAAIFAAAFYSLFNLFSGFFIPRPRIPGWWIWYYWICPLAWTVYGLIVSQYGDIQNTINVPGMPNDPTIKWYVKDHFGYEPNFMAPVAIVLVGFAVFFAFMYAYCLKTLNFQMR

HMMPfam: PF01061
IPR013525
3-186 ABC2_membrane
ABC-2 type transporter

ALMVGTIFWKIGKKRESSGDLQTIIGAMYAAVLFVGINNCSTVQPIVATERTVFYRETAAGMYSALPYAMAQVFVEIPYVFIQTTYYTLIVYAMVSFEWTAAKFFWFFFINFFSFLYFTYYGMMTVSITPNHQVAAIFAAAFYSLFNLFSGFFIPRPRIPGWWIWYYWICPLAWTVYGLIVSQY

HMMPanther: PTHR19241
3-249 FAMILY NOT NAMED,ATP-BINDING CASSETTE TRANSPORTER

ALMVGTIFWKIGKKRESSGDLQTIIGAMYAAVLFVGINNCSTVQPIVATERTVFYRETAAGMYSALPYAMAQVFVEIPYVFIQTTYYTLIVYAMVSFEWTAAKFFWFFFINFFSFLYFTYYGMMTVSITPNHQVAAIFAAAFYSLFNLFSGFFIPRPRIPGWWIWYYWICPLAWTVYGLIVSQYGDIQNTINVPGMPNDPTIKWYVKDHFGYEPNFMAPVAIVLVGFAVFFAFMYAYCLKTLNFQMR

Seg: seg
106-120 seg

FFWFFFINFFSFLYF






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox