PRGDB00064737 (Aan.12465)

From PRG Wiki
Jump to: navigation, search
Aan.12465
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 159704789 (EY080774)
Gene Class Unknown
Domain Type Ser-Thr Kinase
Gene Species Artemisia annua

Comment?

CAZI14483.rev CAZI Artemisia annua normalized leaf library Artemisia annua cDNA clone CAZI14483 3', mRNA sequence

DNA Sequence

AATGAATGTAAAACTATCTAGCAAATATTACCAGCATACACGTATGTATAACCCTTATTGAATATTCACCTTATACTTTACATTACGAGTTTACATTTTATTTGAAATAAGCAAATTAATTTAGCTATACACATAACATAAACAGTTGAGAACAAGACTACACAAAACATTGTCGTCGTTCCATATATTACACCGAGGCCACTGTGATCTCATATTTCCTCATGATTGGTGTTCCCGTTGCCACTGTAGAGTTACTAACTACATCGGATGAAGACCAACCAGAAGAAACAGCATTCCAAGCTATCCGAGTGACAGTATCACCAGACTCGCCAACCCCTGAAATCAAATGGGAGAAAGGATTCAAAGGATCTGGCACCTCTAATGCACCTTCCAACATTTTCACAACGATACTCATCACCGGCCTAGTCTCGGGCCTATATTGAACGCAACAAAGAGCCACCTTAAGCATCCTTTCGACAACTTCTTGATCATTCTTCTCAATGCCACAGTACGTCATCAAAACGTTCAATTCTTTCTTTTCATACAAGTTCCATGCCCATAGCGGGAACCACTGTAGACTATCACCAAGAGTGGTGTCCATATTCCTCCTCCTTCCAATGATCTCAAAAAGTAGCATACCAAAACTATAAACGTCACACTTGTGTGTAACTGGTTGGGGCATCCAGAGCTCGGGAGCAGCATAGCCAGGGGTACCCCGTCCACCTGTCATAGTTATATGCGTGTTTTCCCTATTGAAAAGTTTGGCTAAACCAAAATCGGCCACTTTAGCACAAAAGTTTGCAT


Protein sequences

Name Description Sequence
Aan.12465 translated coding region predicted by ESTScan from UniGene Aan.12465

XANFCAKVADFGLAKLFNRENTHITMTGGRGTPGYAAPELWMPQPVTHKCDVYSFGMLLFEIIGRRRNMDTTLGDSLQWFPLWAWNLYEKKELNVLMTYCGIEKNDQEVVERMLKVALCCVQYRPETRPVMSIVVKMLEGALEVPDPLNPFSHLISGVGESGDTVTRIAWNAVSSGWSSSDVVSNSTVATGTPIMRKYEITVASV

Domains

Domain Start-End Description Sequence

ProfileScan: PS50011
IPR000719
1-152 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

XANFCAKVADFGLAKLFNRENTHITMTGGRGTPGYAAPELWMPQPVTHKCDVYSFGMLLFEIIGRRRNMDTTLGDSLQWFPLWAWNLYEKKELNVLMTYCGIEKNDQEVVERMLKVALCCVQYRPETRPVMSIVVKMLEGALEVPDPLNPFS

superfamily: SSF56112
IPR011009
2-146 Protein kinase-like (PK-like)
Protein kinase-like domain

ANFCAKVADFGLAKLFNRENTHITMTGGRGTPGYAAPELWMPQPVTHKCDVYSFGMLLFEIIGRRRNMDTTLGDSLQWFPLWAWNLYEKKELNVLMTYCGIEKNDQEVVERMLKVALCCVQYRPETRPVMSIVVKMLEGALEVPD

Gene3D: G3DSA:1.10.510.10
3-141 no description

NFCAKVADFGLAKLFNRENTHITMTGGRGTPGYAAPELWMPQPVTHKCDVYSFGMLLFEIIGRRRNMDTTLGDSLQWFPLWAWNLYEKKELNVLMTYCGIEKNDQEVVERMLKVALCCVQYRPETRPVMSIVVKMLEGA

HMMPfam: PF00069
IPR017442
6-131 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

AKVADFGLAKLFNRENTHITMTGGRGTPGYAAPELWMPQPVTHKCDVYSFGMLLFEIIGRRRNMDTTLGDSLQWFPLWAWNLYEKKELNVLMTYCGIEKNDQEVVERMLKVALCCVQYRPETRPVM

HMMPanther: PTHR24420
7-203 FAMILY NOT NAMED,FAMILY NOT NAMED

KVADFGLAKLFNRENTHITMTGGRGTPGYAAPELWMPQPVTHKCDVYSFGMLLFEIIGRRRNMDTTLGDSLQWFPLWAWNLYEKKELNVLMTYCGIEKNDQEVVERMLKVALCCVQYRPETRPVMSIVVKMLEGALEVPDPLNPFSHLISGVGESGDTVTRIAWNAVSSGWSSSDVVSNSTVATGTPIMRKYEITVA

HMMPanther: PTHR24420:SF834
7-203 OS04G0655400 PROTEIN (FRAGMENT)

KVADFGLAKLFNRENTHITMTGGRGTPGYAAPELWMPQPVTHKCDVYSFGMLLFEIIGRRRNMDTTLGDSLQWFPLWAWNLYEKKELNVLMTYCGIEKNDQEVVERMLKVALCCVQYRPETRPVMSIVVKMLEGALEVPDPLNPFSHLISGVGESGDTVTRIAWNAVSSGWSSSDVVSNSTVATGTPIMRKYEITVA

Seg: seg
173-188 seg

VSSGWSSSDVVSNSTV






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox