PRGDB00065652 (Afp.4818)

From PRG Wiki
Jump to: navigation, search
Afp.4818
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 75458138 (DT767076)
Gene Class RLP
Domain Type LRR, Ser-Thr Kinase
Gene Species Aquilegia formosa x Aquilegia pubescens

Comment?

EST1200925 Aquilegia cDNA library Aquilegia formosa x Aquilegia pubescens cDNA clone CO1ZI88, mRNA sequence

DNA Sequence

TTAATGGTCTAAAACAATATTTACACATTAAGGTTACATAAAACATGTAACAAAAGCTATCGAATACTACTAATTTGCCTAAGACCTTGCAATCCACATTTTGTGGCATCTAATCTAGTCTCCCGTGCACGCAGAACAACATGCTGTAATAGAAATTTAACTAATGTATGCGAAGATTAAAAATGATCTAGTCTTACACTACTCTGACAATATAAGAAACTAGGAGTCCAAGATGCGCCGAATCCTTCATGTGTATCCTTGCAGCATCCAATTATCATAGGAAAAAACGATCTATCATTTATCGAGTAGACCCAAGTGGACTAACTTCAAAATGTTGTTCACTCTCCTCTGTGCGAGTAGATGGTACAGAATATGGCCCATTGTTTGAATTAAGATAACCACTTTCCTCTCCATTTGTTTTTGACGAATGGGTATATGGTCCATCGGTTAACATACTTTGGGTTTCAGTCTCGCTATGTATTTGCCAAAAATGATTTCGAATTGCTTTAACTCTTGAATCAATTGTTGAAAATCCCGGGTCAGAAAGCAAGTCTTGAATGGGTGTTCTTCCTTCCAGCATGCTAACTACTTGAGACATGGTAGGTCTAAGTGTAGGAGATGCACTAGTGCACAACAGAGATACGTTTAACATCACCATTGCCTCTTCTGTGGAGAATTCTGATCCTAAGTTCGGGTCAACCAACTCTAATAGACTCCCTCTCTCTTGCAAAACAATTGCCCAGTCTAGAAGATAAACAAATTCCTCCTTCGGTCTATAGTTTGTATTGCTTTTCCCGCTTACAAGTTCCAATGCAACAACTCCAAAGCTATAAACATCTGCTTTATCAGTCAAGTAACCACGCATCGCGTATTCTGGAGCCATATAACCTATTGTGCCAGCTACCCGAGTGCTGATGTGTGTATTGTCCTCCTCGTGTAGCTTTGCTAAACCAAAGTCAGA


Protein sequences

Name Description Sequence
Afp.4818 translated coding region predicted by ESTScan from UniGene Afp.4818

SDFGLAKLHEEDNTHISTRVAGTIGYMAPEYAMRGYLTDKADVYSFGVVALELVSGKSNTNYRPKEEFVYLLDWAIVLQERGSLLELVDPNLGSEFSTEEAMVMLNVSLLCTSASPTLRPTMSQVVSMLEGRTPIQDLLSDPGFSTIDSRVKAIRNHFWQIHSETETQSMLTDGPYTHSSKTNGEESGYLNSNNGPYSVPSTRTEESEQHFEVSPLGSTR

Domains

Domain Start-End Description Sequence

superfamily: SSF56112
IPR011009
1-175 Protein kinase-like (PK-like)
Protein kinase-like domain

SDFGLAKLHEEDNTHISTRVAGTIGYMAPEYAMRGYLTDKADVYSFGVVALELVSGKSNTNYRPKEEFVYLLDWAIVLQERGSLLELVDPNLGSEFSTEEAMVMLNVSLLCTSASPTLRPTMSQVVSMLEGRTPIQDLLSDPGFSTIDSRVKAIRNHFWQIHSETETQSMLTDGP

Gene3D: G3DSA:1.10.510.10
1-129 no description

SDFGLAKLHEEDNTHISTRVAGTIGYMAPEYAMRGYLTDKADVYSFGVVALELVSGKSNTNYRPKEEFVYLLDWAIVLQERGSLLELVDPNLGSEFSTEEAMVMLNVSLLCTSASPTLRPTMSQVVSML

HMMPanther: PTHR24420:SF696
1-191 LEUCINE-RICH REPEAT FAMILY PROTEIN / PROTEIN KINASE FAMILY PROTEIN

SDFGLAKLHEEDNTHISTRVAGTIGYMAPEYAMRGYLTDKADVYSFGVVALELVSGKSNTNYRPKEEFVYLLDWAIVLQERGSLLELVDPNLGSEFSTEEAMVMLNVSLLCTSASPTLRPTMSQVVSMLEGRTPIQDLLSDPGFSTIDSRVKAIRNHFWQIHSETETQSMLTDGPYTHSSKTNGEESGYLN

HMMPanther: PTHR24420
1-191 FAMILY NOT NAMED,FAMILY NOT NAMED

SDFGLAKLHEEDNTHISTRVAGTIGYMAPEYAMRGYLTDKADVYSFGVVALELVSGKSNTNYRPKEEFVYLLDWAIVLQERGSLLELVDPNLGSEFSTEEAMVMLNVSLLCTSASPTLRPTMSQVVSMLEGRTPIQDLLSDPGFSTIDSRVKAIRNHFWQIHSETETQSMLTDGPYTHSSKTNGEESGYLN

ProfileScan: PS50011
IPR000719
1-139 PROTEIN_KINASE_DOM
Protein kinase, catalytic domain

SDFGLAKLHEEDNTHISTRVAGTIGYMAPEYAMRGYLTDKADVYSFGVVALELVSGKSNTNYRPKEEFVYLLDWAIVLQERGSLLELVDPNLGSEFSTEEAMVMLNVSLLCTSASPTLRPTMSQVVSMLEGRTPIQDLL

HMMPfam: PF00069
IPR017442
1-60 Pkinase,Ser-thr
Serine/threonine-protein kinase-like domain

SDFGLAKLHEEDNTHISTRVAGTIGYMAPEYAMRGYLTDKADVYSFGVVALELVSGKSNT






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox