PRGDB00065663 (Afp.5832)

From PRG Wiki
Jump to: navigation, search
Afp.5832
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 75452990 (DT763754)
Gene Class Unknown
Domain Type
Gene Species Aquilegia formosa x Aquilegia pubescens

Comment?

EST1197603 Aquilegia cDNA library Aquilegia formosa x Aquilegia pubescens cDNA clone CO1YY32, mRNA sequence

DNA Sequence

GAAGGAAAGAGTTTGTGTTACAGGAGGTGGAGGGTATCAGGCTTCATGGCTGATCAAGTTGCTCCTTTCCAAGGGTTACATGGTACATGCAACTGTCAGAGACCCAAATGATGAGAAAAATGCTCATTTGAAGAAATTCGAAAAAGCATCAGAGAATTTACTACTCTTTAAGGCAGACTTGCTGGACTACGACAACCTCTGCTCTGCCATTGCAGGATGTATAGGAGTTTTCCATGTTGCAAGTCCAGTTCCTCCGACCAGTGTACAGAACCCTGAGGTAGAACTGATTGAACCAGCAGTGACAGGTACATCTAATGTCCTCAAGGCATGTTCCCTGTCAAATGTAAACAGGGTTGTGGTTGTGTCATCTATTGCGGCTATTATTTTAAATCCAAACTGGCCAAAGGATAGAATAATGGATGAATCATGTTGGTCAGACAAGGAGTATTGCAAGACAACTGAGAAATGGTATGCTCTTTCAAAAACAGAAGCAGAAGGCCAGGCCATTGAGTATTCAGAGACAACTGGACTCGATGTTGTTACAGTTTGTCCATCCCTTATTCTTGGGCCAATGTTGCAGTCTACTGTGAATGCTAGTAGCTTAATTCTTCTCAAGCTCTTGAAAGATGGGCTTGATACCATAGAGAACAAACTTCGAGCTATTGTAGATGTTCGAGATGTTGCTGAAGCACTGGTTCAAGCCTATGAGAAAACAGAAGCAAAAGGAAGGTACATATGTGCAACTCACATGATCACGGCAAAGGATTTGGTAAACAAGCTTAGTAGCATCTACCCAAGTTTTGATATCCAAAAAGTTTTGGCCCAGAAGAGGAGCTGGGTACAGGAAAGGGGGTGACCTCAGAGAAACTTC


Protein sequences

Name Description Sequence
Afp.5832 translated coding region predicted by ESTScan from UniGene Afp.5832

XKERVCVTGGGGYQASWLIKLLLSKGYMVHATVRDPNDEKNAHLKKFEKASENLLLFKADLLDYDNLCSAIAGCIGVFHVASPVPPTSVQNPEVELIEPAVTGTSNVLKACSLSNVNRVVVVSSIAAIILNPNWPKDRIMDESCWSDKEYCKTTEKWYALSKTEAEGQAIEYSETTGLDVVTVCPSLILGPMLQSTVNASSLILLKLLKDGLDTIENKLRAIVDVRDVAEALVQAYEKTEAKGRYICATHMITAKDLVNKLSSIYPSFDIQKVLAQKRSWVQERG

Domains

Domain Start-End Description Sequence

HMMPanther: PTHR10366:SF74
2-266 SUBFAMILY NOT NAMED,SUBFAMILY NOT NAMED

KERVCVTGGGGYQASWLIKLLLSKGYMVHATVRDPNDEKNAHLKKFEKASENLLLFKADLLDYDNLCSAIAGCIGVFHVASPVPPTSVQNPEVELIEPAVTGTSNVLKACSLSNVNRVVVVSSIAAIILNPNWPKDRIMDESCWSDKEYCKTTEKWYALSKTEAEGQAIEYSETTGLDVVTVCPSLILGPMLQSTVNASSLILLKLLKDGLDTIENKLRAIVDVRDVAEALVQAYEKTEAKGRYICATHMITAKDLVNKLSSIYP

HMMPanther: PTHR10366
2-266 FAMILY NOT NAMED,NAD DEPENDENT EPIMERASE/DEHYDRATASE

KERVCVTGGGGYQASWLIKLLLSKGYMVHATVRDPNDEKNAHLKKFEKASENLLLFKADLLDYDNLCSAIAGCIGVFHVASPVPPTSVQNPEVELIEPAVTGTSNVLKACSLSNVNRVVVVSSIAAIILNPNWPKDRIMDESCWSDKEYCKTTEKWYALSKTEAEGQAIEYSETTGLDVVTVCPSLILGPMLQSTVNASSLILLKLLKDGLDTIENKLRAIVDVRDVAEALVQAYEKTEAKGRYICATHMITAKDLVNKLSSIYP

Gene3D: G3DSA:3.40.50.720
IPR016040
3-227 no description
NAD(P)-binding domain

ERVCVTGGGGYQASWLIKLLLSKGYMVHATVRDPNDEKNAHLKKFEKASENLLLFKADLLDYDNLCSAIAGCIGVFHVASPVPPTSVQNPEVELIEPAVTGTSNVLKACSLSNVNRVVVVSSIAAIILNPNWPKDRIMDESCWSDKEYCKTTEKWYALSKTEAEGQAIEYSETTGLDVVTVCPSLILGPMLQSTVNASSLILLKLLKDGLDTIENKLRAIVDVRD

superfamily: SSF51735
3-276 NAD(P)-binding Rossmann-fold domains

ERVCVTGGGGYQASWLIKLLLSKGYMVHATVRDPNDEKNAHLKKFEKASENLLLFKADLLDYDNLCSAIAGCIGVFHVASPVPPTSVQNPEVELIEPAVTGTSNVLKACSLSNVNRVVVVSSIAAIILNPNWPKDRIMDESCWSDKEYCKTTEKWYALSKTEAEGQAIEYSETTGLDVVTVCPSLILGPMLQSTVNASSLILLKLLKDGLDTIENKLRAIVDVRDVAEALVQAYEKTEAKGRYICATHMITAKDLVNKLSSIYPSFDIQKVLAQ

HMMPfam: PF01370
IPR001509
5-245 Epimerase
NAD-dependent epimerase/dehydratase

VCVTGGGGYQASWLIKLLLSKGYMVHATVRDPNDEKNAHLKKFEKASENLLLFKADLLDYDNLCSAIAGCIGVFHVASPVPPTSVQNPEVELIEPAVTGTSNVLKACSLSNVNRVVVVSSIAAIILNPNWPKDRIMDESCWSDKEYCKTTEKWYALSKTEAEGQAIEYSETTGLDVVTVCPSLILGPMLQSTVNASSLILLKLLKDGLDTIENKLRAIVDVRDVAEALVQAYEKTEAKGRY

Seg: seg
112-131 seg

SLSNVNRVVVVSSIAAIILN

Seg: seg
202-213 seg

LILLKLLKDGLD






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox