PRGDB00065788 (Ahy.11054)

From PRG Wiki
Jump to: navigation, search
Ahy.11054
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 224938300 (GO266928)
Gene Class Unknown
Domain Type NBS
Gene Species Arachis hypogaea

Comment?

VBL1_41_A14_E001.g1 Normalized cDNA library from cotyledon and young leaves of peanut Arachis hypogaea cDNA, mRNA sequence

DNA Sequence

AAACTAAAAAGATTATGGATAAATTGAAGAAGGAGAAGAATGGTGGAAAAAGCAGAAGTGATAATAGTAGGTGCTGGAACTTCAGGTTTAGCTGCTGCAGCATGCTTAACACAAAAATCAGTACCATTCACTCTTCTCGAAAGAGAAGATTGTTTTGCTTCCTTATGGCAAAAATACACCTATGACCGTCTTCACCTTCACCTTGGAAAAAAAGTGTGTGAGCTTCCCTTTCTTCCATTCCCTGATTCCTACCCTCGCTATGTTCCTAAGAAGCTCTTCATTGAGTATTTAGACTCATATGTGAAGCACTTCAACATCAACCCTTTGTACTACAGATCTGTGGAGCTTGCGGAGTTTGATGAGGTGGATCGGAAGTGGAAGGTGAAGGCTAAGAATAGAAGCTCCGGTGAGGTTGAAGAGTATTCTGGAAGGTTCTTGGTGGTGGCTACTGGGGAGACTGCTGAGCCACGTGTCCCTCGGGTTGAAGGTTTGGAGAGTTTCAAAGGGAAAGTGATGCACTCCACAGGATACAAGAATGGGAAGGAGTTCAAAGATGAACATGTTCTTGTTGTTGGTTCTGGTAATTCTGGCATGGAGATTGCTTTGGATTTGTCCAATTTCGGTGCCAAACCTTCCATCATTGTTCGAAGCTCGGTTCATATTCTATCAAGGAATATGATGTATTATTCAGGGATGTTGTTGAAGTATTTGTCCCTAAGCACAGTGGAGAAGCTGCTTGTTATAGTGAGTAGGATAGTGTATGGGGATCTGAGCAAGTATGGGTTACCTTGGCCAAGTGAAGGACCTTTCACCATGAAAATCAAGTATGGCAAGTTTCCTATCATTGACTTGGGAACTATCAAGAAATCAAGCATGG


Protein sequences

Name Description Sequence
Ahy.11054 translated coding region predicted by ESTScan from UniGene Ahy.11054

MVEKAEVIIVGAGTSGLAAAACLTQKSVPFTLLEREDCFASLWQKYTYDRLHLHLGKKVCELPFLPFPDSYPRYVPKKLFIEYLDSYVKHFNINPLYYRSVELAEFDEVDRKWKVKAKNRSSGEVEEYSGRFLVVATGETAEPRVPRVEGLESFKGKVMHSTGYKNGKEFKDEHVLVVGSGNSGMEIALDLSNFGAKPSIIVRSSVHILSRNMMYYSGMLLKYLSLSTVEKLLVIVSRIVYGDLSKYGLPWPSEGPFTMKIKYGKFPIIDLGTIKKSSMX

Domains

Domain Start-End Description Sequence

ProfileScan: PS51257
1-22 PROKAR_LIPOPROTEIN,Prokaryotic membrane lipoprotein lipid attachment site profile.

MVEKAEVIIVGAGTSGLAAAAC

superfamily: SSF51905
1-276 FAD/NAD(P)-binding domain

MVEKAEVIIVGAGTSGLAAAACLTQKSVPFTLLEREDCFASLWQKYTYDRLHLHLGKKVCELPFLPFPDSYPRYVPKKLFIEYLDSYVKHFNINPLYYRSVELAEFDEVDRKWKVKAKNRSSGEVEEYSGRFLVVATGETAEPRVPRVEGLESFKGKVMHSTGYKNGKEFKDEHVLVVGSGNSGMEIALDLSNFGAKPSIIVRSSVHILSRNMMYYSGMLLKYLSLSTVEKLLVIVSRIVYGDLSKYGLPWPSEGPFTMKIKYGKFPIIDLGTIKK

Gene3D: G3DSA:3.50.50.60
6-201 no description

EVIIVGAGTSGLAAAACLTQKSVPFTLLEREDCFASLWQKYTYDRLHLHLGKKVCELPFLPFPDSYPRYVPKKLFIEYLDSYVKHFNINPLYYRSVELAEFDEVDRKWKVKAKNRSSGEVEEYSGRFLVVATGETAEPRVPRVEGLESFKGKVMHSTGYKNGKEFKDEHVLVVGSGNSGMEIALDLSNFGAKPSII

HMMPanther: PTHR23023:SF5
6-276 MONOOXYGENASE,MONOOXYGENASE

EVIIVGAGTSGLAAAACLTQKSVPFTLLEREDCFASLWQKYTYDRLHLHLGKKVCELPFLPFPDSYPRYVPKKLFIEYLDSYVKHFNINPLYYRSVELAEFDEVDRKWKVKAKNRSSGEVEEYSGRFLVVATGETAEPRVPRVEGLESFKGKVMHSTGYKNGKEFKDEHVLVVGSGNSGMEIALDLSNFGAKPSIIVRSSVHILSRNMMYYSGMLLKYLSLSTVEKLLVIVSRIVYGDLSKYGLPWPSEGPFTMKIKYGKFPIIDLGTIKK

HMMPanther: PTHR23023
6-276 FAMILY NOT NAMED,DIMETHYLANILINE MONOOXYGENASE

EVIIVGAGTSGLAAAACLTQKSVPFTLLEREDCFASLWQKYTYDRLHLHLGKKVCELPFLPFPDSYPRYVPKKLFIEYLDSYVKHFNINPLYYRSVELAEFDEVDRKWKVKAKNRSSGEVEEYSGRFLVVATGETAEPRVPRVEGLESFKGKVMHSTGYKNGKEFKDEHVLVVGSGNSGMEIALDLSNFGAKPSIIVRSSVHILSRNMMYYSGMLLKYLSLSTVEKLLVIVSRIVYGDLSKYGLPWPSEGPFTMKIKYGKFPIIDLGTIKK

FPrintScan: PR00469
IPR000103
6-28 PNDRDTASEII
Pyridine nucleotide-disulphide oxidoreductase, cla

EVIIVGAGTSGLAAAACLTQKSV

HMMPfam: PF00743
IPR020946
6-221 FMO-like
Flavin-containing monooxygenase-like

EVIIVGAGTSGLAAAACLTQKSVPFTLLEREDCFASLWQKYTYDRLHLHLGKKVCELPFLPFPDSYPRYVPKKLFIEYLDSYVKHFNINPLYYRSVELAEFDEVDRKWKVKAKNRSSGEVEEYSGRFLVVATGETAEPRVPRVEGLESFKGKVMHSTGYKNGKEFKDEHVLVVGSGNSGMEIALDLSNFGAKPSIIVRSSVHILSRNMMYYSGMLL

FPrintScan: PR00368
IPR013027
7-26 FADPNR
FAD-dependent pyridine nucleotide-disulphide oxido

VIIVGAGTSGLAAAACLTQK

FPrintScan: PR00469
IPR000103
170-194 PNDRDTASEII
Pyridine nucleotide-disulphide oxidoreductase, cla

FKDEHVLVVGSGNSGMEIALDLSNF

FPrintScan: PR00368
IPR013027
174-192 FADPNR
FAD-dependent pyridine nucleotide-disulphide oxido

HVLVVGSGNSGMEIALDLS






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox