PRGDB00066079 (At.23537)

From PRG Wiki
Jump to: navigation, search
At.23537
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 145358781 (NM_123645)
Gene Class Unknown
Domain Type
Gene Species Arabidopsis thaliana

Comment?

Arabidopsis thaliana DFR (DIHYDROFLAVONOL 4-REDUCTASE); dihydrokaempferol 4-reductase (DFR) mRNA, complete cds

DNA Sequence

GAACATACATAGTTGAATCTTTCCCAAAGCACAATCTATCATATAACCACAAAAATGGTTAGTCAGAAAGAGACCGTGTGTGTAACCGGCGCTTCGGGTTTCATCGGTTCATGGCTAGTGATGCGATTACTAGAACGTGGTTACTTTGTTCGTGCCACCGTTCGAGATCCCGGTAATTTGAAGAAAGTACAACATCTTCTTGATTTGCCAAACGCCAAGACGCTACTCACTTTATGGAAGGCTGATTTATCTGAGGAAGGAAGCTACGATGATGCCATAAACGGATGTGACGGTGTTTTCCACGTGGCAACACCCATGGATTTTGAATCAAAAGATCCTGAGAACGAAGTGATAAAGCCGACAGTGAATGGAATGTTGGGGATAATGAAAGCATGTGTTAAGGCAAAGACCGTACGAAGATTCGTATTTACTTCATCTGCCGGAACCGTTAATGTAGAAGAACATCAGAAGAATGTCTATGATGAAAATGATTGGAGTGATCTTGAGTTTATCATGTCCAAAAAGATGACAGGATGGATGTATTTCGTGTCAAAAACGTTAGCGGAGAAAGCAGCGTGGGATTTCGCCGAAGAGAAAGGATTAGATTTCATTAGTATTATTCCAACATTGGTGGTCGGTCCATTCATCACAACGTCTATGCCGCCTAGCCTTATCACCGCGCTCTCTCCTATCACTCGGAACGAGGCGCATTACTCGATCATAAGACAAGGACAGTATGTGCATTTGGACGACTTATGCAACGCTCATATCTTCTTATACGAACAAGCAGCCGCCAAGGGACGTTATATTTGTTCCTCTCATGATGCAACCATTCTTACTATCTCCAAATTTCTCAGGCCAAAATACCCCGAATATAACGTACCTTCAACGTTTGAAGGTGTTGATGAGAATCTAAAGAGCATTGAATTCAGTTCCAAGAAGCTGACGGACATGGGGTTTAACTTCAAGTATAGTCTCGAGGAAATGTTTATTGAATCTATTGAGACATGTCGTCAAAAGGGTTTTCTCCCGGTTTCATTATCGTACCAATCCATATCGGAGATCAAGACTAAGAATGAAAACATTGACGTCAAAACCGGAGATGGTTTAACCGATGGTATGAAGCCATGTAACAAGACAGAAACGGGGATAACCGGCGAGAGAACCGATGCTCCCATGCTAGCACAACAGATGTGTGCCTAGAAAATTCAACTGTTATATTATCATATCGTTTTACTATTGGAGGTGTGATTTGGGTTTATCATTATGTTAATCATAATTTATCATTGGCAAATGATATGAAATGATTTTGTATCGCGTGTGATTGTAACGGTATGAATTAACCTATTTACGTATTT


Protein sequences

Name Description Sequence
At.23537 translated coding region predicted by ESTScan from UniGene At.23537

MVSQKETVCVTGASGFIGSWLVMRLLERGYFVRATVRDPGNLKKVQHLLDLPNAKTLLTLWKADLSEEGSYDDAINGCDGVFHVATPMDFESKDPENEVIKPTVNGMLGIMKACVKAKTVRRFVFTSSAGTVNVEEHQKNVYDENDWSDLEFIMSKKMTGWMYFVSKTLAEKAAWDFAEEKGLDFISIIPTLVVGPFITTSMPPSLITALSPITRNEAHYSIIRQGQYVHLDDLCNAHIFLYEQAAAKGRYICSSHDATILTISKFLRPKYPEYNVPSTFEGVDENLKSIEFSSKKLTDMGFNFKYSLEEMFIESIETCRQKGFLPVSLSYQSISEIKTKNENIDVKTGDGLTDGMKPCNKTETGITGERTDAPMLAQQMCA

Domains

Domain Start-End Description Sequence

superfamily: SSF51735
1-321 NAD(P)-binding Rossmann-fold domains

MVSQKETVCVTGASGFIGSWLVMRLLERGYFVRATVRDPGNLKKVQHLLDLPNAKTLLTLWKADLSEEGSYDDAINGCDGVFHVATPMDFESKDPENEVIKPTVNGMLGIMKACVKAKTVRRFVFTSSAGTVNVEEHQKNVYDENDWSDLEFIMSKKMTGWMYFVSKTLAEKAAWDFAEEKGLDFISIIPTLVVGPFITTSMPPSLITALSPITRNEAHYSIIRQGQYVHLDDLCNAHIFLYEQAAAKGRYICSSHDATILTISKFLRPKYPEYNVPSTFEGVDENLKSIEFSSKKLTDMGFNFKYSLEEMFIESIETCRQ

HMMPanther: PTHR10366:SF9
4-352 CINNAMOYL-COA REDUCTASE,CINNAMOYL-COA REDUCTASE

QKETVCVTGASGFIGSWLVMRLLERGYFVRATVRDPGNLKKVQHLLDLPNAKTLLTLWKADLSEEGSYDDAINGCDGVFHVATPMDFESKDPENEVIKPTVNGMLGIMKACVKAKTVRRFVFTSSAGTVNVEEHQKNVYDENDWSDLEFIMSKKMTGWMYFVSKTLAEKAAWDFAEEKGLDFISIIPTLVVGPFITTSMPPSLITALSPITRNEAHYSIIRQGQYVHLDDLCNAHIFLYEQAAAKGRYICSSHDATILTISKFLRPKYPEYNVPSTFEGVDENLKSIEFSSKKLTDMGFNFKYSLEEMFIESIETCRQKGFLPVSLSYQSISEIKTKNENIDVKTGDGL

HMMPanther: PTHR10366
4-352 FAMILY NOT NAMED,NAD DEPENDENT EPIMERASE/DEHYDRATASE

QKETVCVTGASGFIGSWLVMRLLERGYFVRATVRDPGNLKKVQHLLDLPNAKTLLTLWKADLSEEGSYDDAINGCDGVFHVATPMDFESKDPENEVIKPTVNGMLGIMKACVKAKTVRRFVFTSSAGTVNVEEHQKNVYDENDWSDLEFIMSKKMTGWMYFVSKTLAEKAAWDFAEEKGLDFISIIPTLVVGPFITTSMPPSLITALSPITRNEAHYSIIRQGQYVHLDDLCNAHIFLYEQAAAKGRYICSSHDATILTISKFLRPKYPEYNVPSTFEGVDENLKSIEFSSKKLTDMGFNFKYSLEEMFIESIETCRQKGFLPVSLSYQSISEIKTKNENIDVKTGDGL

Gene3D: G3DSA:3.40.50.720
IPR016040
6-220 no description
NAD(P)-binding domain

ETVCVTGASGFIGSWLVMRLLERGYFVRATVRDPGNLKKVQHLLDLPNAKTLLTLWKADLSEEGSYDDAINGCDGVFHVATPMDFESKDPENEVIKPTVNGMLGIMKACVKAKTVRRFVFTSSAGTVNVEEHQKNVYDENDWSDLEFIMSKKMTGWMYFVSKTLAEKAAWDFAEEKGLDFISIIPTLVVGPFITTSMPPSLITALSPITRNEAHY

HMMPfam: PF01370
IPR001509
8-250 Epimerase
NAD-dependent epimerase/dehydratase

VCVTGASGFIGSWLVMRLLERGYFVRATVRDPGNLKKVQHLLDLPNAKTLLTLWKADLSEEGSYDDAINGCDGVFHVATPMDFESKDPENEVIKPTVNGMLGIMKACVKAKTVRRFVFTSSAGTVNVEEHQKNVYDENDWSDLEFIMSKKMTGWMYFVSKTLAEKAAWDFAEEKGLDFISIIPTLVVGPFITTSMPPSLITALSPITRNEAHYSIIRQGQYVHLDDLCNAHIFLYEQAAAKGR






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox