PRGDB00067751 (Can.7925)

From PRG Wiki
Jump to: navigation, search
Can.7925
Gene Type Putative_R-Genes,_predicted_from_NCBI_UniGene
GenBank 193290677 (EU616555)
Gene Class Unknown
Domain Type
Gene Species Capsicum annuum

Comment?

Capsicum annuum putative cinnamoyl-CoA reductase mRNA, complete cds

DNA Sequence

ATGCCATCGGAATCCGGCAAAGTCGTCTGTGTCACCGGCGCCGGAGGTTTCATTGCTTCTTGGCTTGTTAAAATCCTCCTACAAAAAGGCTACACTGTTAGAGGAACCGTTAGAAATCCTGATGATCCCAAAAATAGTCACTTGAGAGAACTTGAAGGTGCAAAAGAGAGACTGACACTGTGTAGAGCTGATCTTCTGGACTACCAAAGTTTGAGAGAAGCAATCTATGGCTGTGATGGAGTCTTCCACACTGCTTCTCCTGTCACTGATGATCCAGAACAAATGGTGGAGCCAGCAGTAATTGGGACTAAGAATGTGATAACAGCAGCTGCAGAAGCCAAAGTTGGAAGGGTTGTGTTTACTTCGTCAATTGGTGCGGTCTACATGGACCCCGATAGGGCCACCGAGAAAGTTGTGGACGAGACTTGCTGGAGTGATCTCGACTTCTGCAAGAATACTAAGAATTGGTACTGCTATGGGAAAATGGTGGCGGAGAAAACGGCGTGGGATGAGGCAAGGGAAAAAGGAGTGGATTTGGTCGTGATCAACCCAGTGTTGGTGCTTGGACCACTGCTCCAGCCAACAGTGAATGCAAGTGTTCTTCACATACTAAAGTACCTAACTGGCTCTGCCAAAACATATGCCAATTCAGTTCAGGCATATGTTCATGTTAAGGATGTTGCACTTGCCCACATACTTGTCTACGAGACTCGTTCTGCATCTGGCCGCTATATCTGTGCTGAGAGCGTGCTTCATCGCGGCGACGTGGTCGAAATCCTTGCCAAGTTCTTCCCGGAGTATCCCATCCCCACCAAGTGCTCAGACGAGACGAGGCCTAGGGCAAAACCGTACAAATTCTCGAACCAAAAGCTGAAGGACTTGGGCTTGGAGTTTACGCCTGTGAAACAATGCTTATATGAGACAGTGAAGAGTCTGCAGGAGAAGGGTCACCTTCCACTTCCTACTCAAAATGACGAATCTATTCGAGTGATTAGTAGTAATTAA


Protein sequences

Name Description Sequence
Can.7925 translated coding region predicted by ESTScan from UniGene Can.7925

MPSESGKVVCVTGAGGFIASWLVKILLQKGYTVRGTVRNPDDPKNSHLRELEGAKERLTLCRADLLDYQSLREAIYGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEAKVGRVVFTSSIGAVYMDPDRATEKVVDETCWSDLDFCKNTKNWYCYGKMVAEKTAWDEAREKGVDLVVINPVLVLGPLLQPTVNASVLHILKYLTGSAKTYANSVQAYVHVKDVALAHILVYETRSASGRYICAESVLHRGDVVEILAKFFPEYPIPTKCSDETRPRAKPYKFSNQKLKDLGLEFTPVKQCLYETVKSLQEKGHLPLPTQNDESIRVISSN

Domains

Domain Start-End Description Sequence

superfamily: SSF51735
1-314 NAD(P)-bd

MPSESGKVVCVTGAGGFIASWLVKILLQKGYTVRGTVRNPDDPKNSHLRELEGAKERLTLCRADLLDYQSLREAIYGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEAKVGRVVFTSSIGAVYMDPDRATEKVVDETCWSDLDFCKNTKNWYCYGKMVAEKTAWDEAREKGVDLVVINPVLVLGPLLQPTVNASVLHILKYLTGSAKTYANSVQAYVHVKDVALAHILVYETRSASGRYICAESVLHRGDVVEILAKFFPEYPIPTKCSDETRPRAKPYKFSNQKLKDLGLEFTPVKQCLYETVKSLQE

HMMPanther: PTHR10366:SF9
1-326 PTHR10366:SF9,CINNAMOYL-COA REDUCTASE

MPSESGKVVCVTGAGGFIASWLVKILLQKGYTVRGTVRNPDDPKNSHLRELEGAKERLTLCRADLLDYQSLREAIYGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEAKVGRVVFTSSIGAVYMDPDRATEKVVDETCWSDLDFCKNTKNWYCYGKMVAEKTAWDEAREKGVDLVVINPVLVLGPLLQPTVNASVLHILKYLTGSAKTYANSVQAYVHVKDVALAHILVYETRSASGRYICAESVLHRGDVVEILAKFFPEYPIPTKCSDETRPRAKPYKFSNQKLKDLGLEFTPVKQCLYETVKSLQEKGHLPLPTQNDE

HMMPanther: PTHR10366
1-326 PTHR10366,NAD DEPENDENT EPIMERASE/DEHYDRATASE

MPSESGKVVCVTGAGGFIASWLVKILLQKGYTVRGTVRNPDDPKNSHLRELEGAKERLTLCRADLLDYQSLREAIYGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEAKVGRVVFTSSIGAVYMDPDRATEKVVDETCWSDLDFCKNTKNWYCYGKMVAEKTAWDEAREKGVDLVVINPVLVLGPLLQPTVNASVLHILKYLTGSAKTYANSVQAYVHVKDVALAHILVYETRSASGRYICAESVLHRGDVVEILAKFFPEYPIPTKCSDETRPRAKPYKFSNQKLKDLGLEFTPVKQCLYETVKSLQEKGHLPLPTQNDE

Gene3D: G3DSA:3.40.50.720
IPR016040
6-265 NAD(P)-bd
NAD(P)-binding domain

GKVVCVTGAGGFIASWLVKILLQKGYTVRGTVRNPDDPKNSHLRELEGAKERLTLCRADLLDYQSLREAIYGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEAKVGRVVFTSSIGAVYMDPDRATEKVVDETCWSDLDFCKNTKNWYCYGKMVAEKTAWDEAREKGVDLVVINPVLVLGPLLQPTVNASVLHILKYLTGSAKTYANSVQAYVHVKDVALAHILVYETRSASGRYICAESVLHRGDVVEILAKFFP

HMMPfam: PF01370
IPR001509
9-244 Epimerase
NAD-dependent epimerase/dehydratase

VCVTGAGGFIASWLVKILLQKGYTVRGTVRNPDDPKNSHLRELEGAKERLTLCRADLLDYQSLREAIYGCDGVFHTASPVTDDPEQMVEPAVIGTKNVITAAAEAKVGRVVFTSSIGAVYMDPDRATEKVVDETCWSDLDFCKNTKNWYCYGKMVAEKTAWDEAREKGVDLVVINPVLVLGPLLQPTVNASVLHILKYLTGSAKTYANSVQAYVHVKDVALAHILVYETRSASGRY






List of Contributions

There has not been any contribution yet.


Analyses

Blast

Blast matches against Reference R-Genes. Show


Personal tools
Namespaces

Variants
Actions
PRGDB
META-SPECIES
Wiki
Toolbox